Answered: 4. What is the probability that an egg…

4. What is the probability that an egg carrying an X chromosome will be fertilized by sperm carrying an X-chromosome? 00 O 1/4 01 0 1/8 O 1/2

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter18: Evolution And The Origin Of Species

Section: Chapter Questions

Problem 1VCQ: Figure 18.14 Which is most likely to survive, offspring with 2n+l chromosomes or offspring with 2n-l...

See similar textbooks

Related questions

Q: 70203 52000 CHIRAGRA SPIDER CONCH Harpago chiragra Linnaeus 1758 49+0

A: Introduction Characteristics of Mollusca are- 1. They are triploblastic. 2. They are bilaterally…

Q: Describe the relevance of Bioinformatics in supporting the progress of Biotechnology.

A: Bioinformatics: Short for "biological Informatics", Bioinformatics is a new field of biotechnology…

Q: Why is it important for the sperm in internally fertilizing animals to undergo acrosome reaction at…

A: The acrosome reaction that occurs after sperm capacitation, is an exocytotic event induced by a Ca++…

Q: Which of the following would most directly disrupt formation of the adhesion belt? Group of answer…

A: Adhesion belt refers to the continuous band like structures formed between the adjacent cells.The…

Q: Not all prokaryotic cells have flagella. What are bacteria without flagella called?

A: Introduction:- Prokaryotic cells are characterized by absence of a well defined nucleus and membrane…

Q: Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the…

A: Principle of parsimony: The principle of parsimony is made use of when we need to determine which…

Q: 1a. What is the basic structure of a nucleosome? Also what's the key characteristics of histone…

A: Chromosome The highly condenced form of DNA chromatin fibres. These condensation is possible with…

Q: Answer the following 1. Why was Anton van Leeuwenhoek's discovery is important? 2. What is the…

A: Introduction: The natural world was finally explained by experiments and scientific observations…

Q: The alternation of generations life cycle applies to gymosperms in that: A. the gametophyte stage…

A: Gymnosperms are vascular plants that produce seeds but not flowers.

Q: Is there a way to solve without a scientific calculator?

A: Microbes can be destroyed or removed using physical means such as thermal treatment, radiation…

Q: How many species are present at year 1000? Justify your answer (i.e., clearly explain your…

A: The term species can be defined as a group of individuals that are able to inbreed. Speciation is…

Q: How do organisms with less complex systems such as those in protozoans are able to respond to…

A: Introduction Stimuli are detectable change in the internal or external environment. which causes a…

Q: Minimize pipette handling Questions : How important is it to transfer the proper liquids in their…

A: Pipette is a safe method by which small amount of liquid can be transferred from one location to the…

Q: How does translation work? mRNA attaches to a The ribosome lines up complementary molecules. Their…

A: Protein synthesis is a process which occurs after transcription is completed. Transcription is a…

Q: How do potassium ions travel as they move into the cell?A.Up the concentration gradient and up the…

A: Introduction The cell membrane is a structure that surrounds the cell and keeps the organelles…

Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU

A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…

Q: Q1: What is natural selection selecting for here? Q2: Why do bacteria that are not genetically…

A: Natural selection is the process in which the environment selects its organism naturally depending…

Q: Why is it said that photosynthesis and cellular respiration are reverse chemical processes?

A: Photosynthesis :-it is the process of production of food (oxygen and glucose) in the plants by using…

Q: Describe a series of experiments to SELECT and/or SCREEN for strains containing mutations that…

A: There is a chemical called styrene which is used in many industries to make latex, polystyrene…

Q: a) Use this data, and sketch a graph by hand that would best fit the data. (think which type of…

A: Aurelia Aurelia commonly known as jellyfish because of its jelly like materials from which it is…

Q: how to perform a standard plate count.

A: The "standard plate count," a microbiological method, counts the number of bacterial colonies after…

Q: Which factor sets the upper limit of Chthamalus' realized range in the intertidal zone? O Ability to…

A: Introduction :- The area that is above water at low tide and below water at high tide is referred to…

Q: Which of the following statements is TRUE about phospholipids? The hydrophobic fatty acid tails on…

A: Phospholipids are amphiphilic molecules with hydrophobic fatty acid chains and hydrophilic moieties.

Q: What are the characteristics of a high-quality DNA extract? What do you do to determine the quality…

A: DNA extraction is a protocol used for the isolation and purification of DNA from biological samples…

Q: What are the limits to tree height and why?

A: The tree height is a tendency of the tree to become longer. Every tree tries to be as long as…

Q: Which ( somatic or gametes) are made in the process of meiosis?

A: Cell cycle is a series of events that are responsible for producing daughter cells from parent cell.…

Q: Which of the following statements are correct about cytoplasmic signaling in cancer cells? Multiple…

A: Metastasis is a significant cause of mortality worldwide. Cancer cells acquire genetic alterations…

Q: Which of the following statements describes the function of plasma membranes? I. define boundaries…

A: Plasma membrane is a microscopic membrane of lipids and proteins which forms the external boundary…

Q: What is similar among the following animals: chimpanzee, Rhesus monkey, dog, mouse, and rat. Are…

A: Different animals are classified on the basis of their morphological characteristics and…

Q: Construct a cladogram from the data below.

A: A cladogram is also termed "phylograms", these are used to infer the relationship between different…

Q: Why is it important to know if the bacteria is encapsulated or not?

A: Some bacterial cells are surrounded by a viscous substance called a capsule, which forms a covering…

Q: Pasteur used an S-necked flasks to disprove spontaneous generation. Explain the experiments that…

A: Spontaneous generation is a hypothesised theory that attempted to explain the origin of life…

Q: Question 15 of 17 Fill in the blanks: is the wavelength in nanometer used in spectrophotometric…

A: protein estimation is the process of quantifying the protein content of a sample. The protein…

Q: Identify the type of division exhibited by the following: Binary fission Algae (filamentous)…

A: Asexual reproduction The reproduction in which only single parent is required.

Q: The following are the conditions that determines the direction of ions as it pass through the…

A: Transport channel The channel by which the molecules are transported across the membrane.

Q: Different recommended BMI ranges exist for people of different ethnic groups. This is partially due…

A: Answer : True

Q: Match the following: Cleavage Gametogenesis Fertilization Blastula formation Formation of organs…

A: Developmental biology The study of process of development of animal and plants.

Q: why does DNA breathing occur?

A: Introduction: DNA serves as the template and substrate for many important biological processes,…

Q: Which of the following pathways would you expect to be inhibited by drugs that prevent import of…

A: Explanation: Since the import of proteins into the nucleus is part of the TGF-Beta signalling…

Q: Please answer fast Question #1: Use answers A-L to answer questions 1-6 below. They can be used…

A: Hydrogen bonds are a main characteristic of protein shape. By a usually usual definition, they…

Q: Which of the following would be a properly identified and acceptable specimen? 1. needle biopsy…

A: The properly identified and acceptable specimen may include: needle biopsy with patient's medical…

Q: species are most broadly distributed, which have the smallest range? List at least 3 names per each…

A: Species of organisms are distributed worldwide according to their adaptation ability and the…

Q: The difference in charge and chemical concentration across a membrane is known as Membrane gradient…

A: Electrochemical gradient is The gradient is made up of two components: an electrical gradient and a…

Q: Which of the following is the THICKEST? Right ventricle endocardium Right atrial epicardium Right…

A: * Heart is the main pumping organ in body.The function of heart is to pump blood throughout the body…

Q: B-lymphocytes convert into plasma cells, before they produce antibodies. Which of the following…

A: phagocytes, a type of living cell, devour or engulf other cells or particles through a process known…

Q: Identify three enzymes found in the body, their likely location inside the body, and the pH at which…

A: Enzymes are biocatalyst that perform specific chemical reaction. They are proteinaceous in nature…

Q: Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

A: The process of speciation is how populations develop into separate species. When populations are…

Q: Three risk factors of cancer.

A: Introduction A group of diseases known as cancer involve abnormal cell proliferation and have the…

Q: substance that do not dissolve well in water are a. hydrophobic b. hydrophilic c.isotonic…

A: Introduction :- An substance that is attracted to water molecules and has a propensity to dissolve…

Q: QUESTION 4 Although physical features such as teeth are good for classification, only DNA can be…

A: Introduction : A phylogenetic tree, also known as phylogeny, is a picture that shows how different…

Question

4. What is the probability that an egg carrying an X chromosome will be fertilized by sperm carrying an X-chromosome?
0 0
O 1/4
01
O 1/8
O 1/2

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

6. What is the probability that an egg bearing a Y- chromosome be fertilized by a sperm carrying an X-chromosome? O 1/8 O 1/4 0 0 01/2 0 1
14. Label the phases of Meiosis and annotate any important events or features. 9--0-
IV. Observation: No Crossing Over Crossing Over Appearance of Gamete Cells Appearance of Gamete Cells V. Analysis: 1. If the two sister chromatids are the same, how are they called? 2. Which specific parts exchanged genetic information during cross over? 3. What is crossing over? 4. When will crossing over occurs? Why? 5. What will happen after crossing over? 6. How do meiosis contributes to genetic variation, while mitosis does not? 7. Why is crossing over important for evolution of species?
Answer the following: 1. What sex chromosome combination does a female have? 2. What sex chromosome combination does a male have?, 3. How many chromosomes are in normal human cells? Use the internet to define karyotype: Karyotype - The pictures below show normal (all 46 non-damaged chromosomes) }} 88 31 10 71 al X X X X 46,XX id ZWK99010 KEY 28 20 38 21 AC 11 RR 16 8.8 22 10 17 X 11 Female Karyotype (2 X chromosomes) Male Karyotype (XY chromosomes) Why would scientists use karyotypes? Scientists use karyotypes to diagnose genetic disorders. A karyotype can show if there are extra, missing, or structurally damaged chromosomes. Predict: What could cause someone to have missing or damaged chromosomes?
5. An egg parent with type A blood is claiming that a person with type AB blood is the sperm parent of the child who is type B. Could this person be a sperm parent of the child? Show the possible crosses Assuming that this person is sperm parent of the child, what must be the genotype of the egg parent? 10 15 O stv w PDF MacBook 80 F3 DII F4 F5 F7 F9 F10 $ % & 4 5 7 8. E Y P F H J K V V B ト

Arial 11 BIUA 田回▼ 三=三|三|: 12 II 4. Below is a diploid cell in meiosis. a. Label one set of homologous chromosomes, one set of sister chromatids and one set of heterologous chromosomes. b. How many alleles of the 'A' alleles are present in the cell at Prophase 1? c. How many copies of the 'A' genes are present in each cell at Prophase II? d. How many 'a' alleles are present in Anaphase 1? e. How many 'F' alleles are present in each cell in Metaphase I? f. How many 'f alleles are present in each cell in Metaphase ll? g. How many 'F' genes are present in each gamete? h. How many chromosomes will be present in each gamete? MacBook Air
9. Consider the below Punnett square cross. Explain how you could use it to determine which parent determines the biological sex of a baby---is it the mother, father, or both? Why? X Y X
Human females have two X chromosomes (XX); males have one X and one Y chromosome (XY). a. With respect to X-linked alleles, how many different types of gametes can a male produce? b. If a female is homozygous for an X-linked allele, how many types of gametes can she produce with respect to that allele? c. If a female is heterozygous for an X-linked allele, how many types of gametes can she produce with respect to that allele?
The genotype XXY corresponds to Klinefelter syndrome Turner syndrome Triplo-X Jacob syndrome
Figure 18.14 Which is most likely to survive, offspring with 2n+l chromosomes or offspring with 2n-l chromosomes?
The DNA content in a diploid cell in G2 is X. If that cell goes into meiosis at metaphase II, the DNA content will be: a. 0.1 X. b. 0.5 X. c. X. d. 2X. e. 4X.
Human females have two X chromosomes (XX); males have one X and one Y chromosome (XY). a. With respect to X chromosome alleles, how many different types of gametes can a male produce? b. If a female is homozygous for an allele on an X chromosome, how many types of gametes can she produce with respect to that allele? c. If a female is heterozygous for an X chromosome allele, how many types or gametes can she produce with respect to that allele?