37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an aspartic acid amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? What amino acid will be attached to the amino group of the histidine encoded by this mRNA?

37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an aspartic acid amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? What amino acid will be attached to the amino group of the histidine encoded by this mRNA?

Name: 37. A portion of an mRNA attached to a ribosome reads:5′ UUUGACCCCACG
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 37. A portion of an mRNA attached to a ribosome reads:5′ UUUGACCCCACG 3′If a tRNA with an aspartic acid amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site?What amino acid will be attached

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…
What will be the overall anti-codon sequence in tRNA for this mRNA? 5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’
A poison added to an in vitro translation mixture containing mRNA molecules with the sequence 5'- AUGAAAAAAAAAAAAUAA-3' has the following effect: the only product made is a Met-Lys dipeptide that remains attached to the ribosome. What is the most likely way in which the poison acts to inhibit protein synthesis? It mimics a methionine tRNA. O It inhibits stop proteins from entering the ribosome O It inhibits movement of translocation so it can't empty the P-site O It inhibits the P site from accepting a tRNA to begin with
30. Below is a pre-mRNA sequence that contains 2 exons and an intronic region. Based on your knowledge of the spicing reaction, predict the ligated exon sequence. [ | (hint: there is a consensus sequence for this "cut n paste' rxn.] 5'-ACGACAGGAUGAAGGUAAAUCGGGUAGGGGCGGCUGACUCUCUUUUUCCCUCAGGUCGUAA-3'
41. The following 9 TRNAS have anticodon loop regions that base pair with the mRNA in the ribosome. Using your knowledge of tRNA-MRNA base pairing and the genetic code chart (+lecture slides), indicate the MRNA codon message being read by the ribosome as well as the1-letter amino acids that is generated. Anticodon Anticodon Anticodon Anticodon 4 Anticodon Anticodon 6. 2 5'-IAG-3' 5'-UAU-3' 5'-АAА-3' 5'-CUC-3' 5'-GAU-3' 5'-AGA-3' codon MRNA 5'-__-3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 1 letter amino acid Anticodon Anticodon Anticodon 8 7 5'-CCG-3' 5'-GUU-3' 5'-CGC-3' codon 5'-__-3' 5' 3' 5' _3' mRNA 1 letter amino acid
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G
The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence State the amino acid sequence of the polypeptide translated from this mRNA Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.
One of the codons in mRNA that specifies the amino acid phenylalanine is UUC. What is the anticodon on the tRNA that carries phenylalanine?
Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'
Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAi Met were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal