3. Design an experiment to determine whether a protein is an ion channel or a transporter. Provide some key details on how you would conduct the experiment.
Q: could you please write the equation on paper with pen? I cannot understand the equation clearly.
A: The competitive inhibitors are the molecules which inhibits the enzyme catalyzed reaction by binding…
Q: 4. If a non-science person asks you what protein folding is and how the concept is related to…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes that…
Q: Glucagon causes [Select] Glucagon cause [Select] [Select] ✓ [Select] Glucagon causes [Select]…
A: Hormone glucagon is secreted by the pancreas in response to low glucose level. Glucagon primarily…
Q: Identify examples of a carbohydrate that is: unbranched, reducing monosaccharide
A: Chemically, carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Do carbohydrates and sugars cause weight gain? Briefly Explain the answer.
A: Carbohydrates are biomolecules that act as the major source of energy. Sugars are carbohydrates with…
Q: true or false: Pyrimidine synthesis involves the use of a molecule of N10-formyl…
A: Pyrimidine is one of the bases required in the nucleotides formation.
Q: Once AMP and GMP are synthesized, they are then converted to ADP and GDP, then to ATP and GDP. What…
A: Adenosine & Guanosine are purine nitrogen bases. To these phosphate groups are attached. AMP…
Q: Wobble hypothesis indicates that: a. fatty acids are degraded 2 carbons at a time. O b.…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: The inhibition of PFK-1 by ATP diminishes when the ADP concentration is high, as shown in the graph…
A: PFk-1 is an enzyme involved in glycolysis. It catalyzes the conversion of fructise-6-phoaphate to…
Q: The expresion ytou have like [deprotonate][protonate]. Are they multiplying or dividing? Is not…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: Make 2 mL of 50 fold dilution of DNA solution and sodium phosphate buffer. DNA: 400 uL Sodium…
A: Dilution is the process of lowering the concentration of a solution by adding more of solvent to it.…
Q: An individual's blood sugar is low. Assuming normal regulatory patterns, are the following ratios…
A: If the blood glucose level is low, we need to reduce the rate of glycolysis as there is insufficient…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: A dipeptide is a two amino acid linked via a peptide bond. The peptide bond is formed between the…
Q: Catabolism - draw the complete citric acid cylcle for myristate
A: Myristate is a saturated fatty acid with 14 carbon atoms. Fatty acids are metabolized through the…
Q: Xylulose and ribulose are epimer pairs. Please explain why and how to identify epimer pairs
A: Epimers are the simple Sugars that differ in a single chiral centre or in the arrangement of OH…
Q: What structural and functional advantages do proteins gain by associating to form quaternary…
A: In cellular environments, protein interaction networks contain crucial functional modules made up of…
Q: Defects in the Citrate Cycle are rare but have been described. Based on the level of metabolites…
A: Glycolysis consists of 10 enzymatically catalysed reactions that convert one 6-carbon molecule of…
Q: If the target protein is 0.1% of the total protein in the original mixture, a three-step…
A: Purification is a process by which impurities are removed from a sample and desired component is…
Q: In addition to the oxidation of cytochrome c by Comple transport systems, what other reaction is…
A: Introduction The electron transport chain (ETC) is the last part of aerobic respiration. An electron…
Q: The citric acid cycle is shown. The methyl carbon in acetyl CoA is labeled with C14C14 (shown in…
A: Citric acid cycle - it is also called as Krebs cycle or the TCA cycle (tricarboxylic acid cycle)…
Q: 5) The nucleotides in the backbone of DNA are held together by bonds. A) hydrogen B) peptide…
A: Nucleic acids are composed of nucleotides (sugar, nitrogenous base & phosphate group). Nucleic…
Q: C. Mucic Acid Test for Galactose and Lactose describe the appearance of a few typical crystals…
A: Galactose and lactose can be found using the highly specific mucic acid test, which is used to…
Q: 7. Specificity of membrane transporters. A protein that transports amino acids across the cell…
A: In competitive inhibition, the inhibitor competes with the substrate for binding at the active site…
Q: Which of the following is TRUE under the following conditions: the enzyme concentration is 2.5 nM,…
A: The rate of reaction can be determined by using Michaelis Menten equation. Michaelis Menten equation…
Q: Virtually all animal cells have a Na+/K+ pump. Which of the following statements concerning it is…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Is increasing the P; concentration a reasonable way to couple ATP hydrolysis and glucose…
A: It makes sense to relate ATP hydrolysis and glucose phosphorylation by increasing the P…
Q: Glycogen synthase in the liver is a target for phosphorylation by two protein kinases. What are…
A: Glycogen is a storage-type homopolysaccharide that contains two types of glucose polymers: amylose:…
Q: Question 3: A runner just finished a marathon. For the enzymes listed below, indicate whether the…
A: During the marathon, the runner required extra glucose in the blood for physical activity.…
Q: General functions of the cytoskeleton maintains the cell shape movement of proteins and lipids…
A: The cytoskeleton is a structural framework made up of protein filaments: actin filaments,…
Q: answer question 2 please asap
A: Polymerase chain reaction (PCR) can amplify a single target DNA fragment from a complex mixture of…
Q: How many mL of 19 mM SDS would you need to make 76 mL of 2 mM SDS? Report your answer rounded to 1…
A: Molarity is a way of representing the concentration of a solution. Molarity is the number of moles…
Q: Convert 475 cal to joules
A: Calories, joules are used to determine the amount of energy present in the food . The energy given…
Q: Epinephrine has the following structure. Which of the following amino acids are used by the…
A: Phe, Val, and Leu are hydrophobic amino acids that do not participate in H bonds or electrostatic…
Q: Explain the importance of solubility in drug product formulation. 2.
A: Solubility, the phenomenon of dissolving a solute in a solvent to produce a homogeneous system, is…
Q: hat roles do ionizable amino acids play in the active sites of enzymes
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 13. Southern blotting is separation of DNA by agarose electrophoresis and probing with a labeled…
A: The 'blot' in the different blotting techniques (southern, northern, western and eastern blotting)…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: 2. What molecule does not bind to hemoglobin? O (a) Carbon monoxide (CO) O (b)…
A: Our red blood cells (RBCs) are composed of hemoglobin that helps to transport oxygen throughout the…
Q: How much ATP will be produced from the Beta-oxidation of lauric acid a C 12 saturated fatty acid?…
A: Lauric acid is a saturated fatty acid with 12 carbon atoms. The molecular formula of lauric acid is…
Q: In one form of thalassemia, the mutation of a single base from G to A generates a new 3' splice site…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: One of the functions of the pentose phosphate pathway is to make NADPH, which plays important roles…
A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…
Q: does BPG bind to deoxyhemoglobin only?why BPG does not bind to oxyhemoglobin? what is chemical…
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: Please explain the formula (process) used to get the Red undelived numbers, Thanks!! example each…
A: Enzyme kinetics - Enzymes are usually comprise of protein molecules which is used to catalyzed…
Q: Which enzyme in PPP creates glyceraldehyde 3 phosphate as a product? (Select all that apply)…
A: Pentose phosphate pathway (PPP) is an anabolic pathway that synthesizes pentose sugars and NADPH…
Q: Which of the following stabilize the hemoglobin quaternary structure of low-affinity to oxygen…
A: Haemoglobin is an important protein present in RBCs. It coprises of four subunits. Each subunit has…
Q: Given the Fischer projection structure of D-Lasallose below, show the step by step process of…
A: Given to us is a 7 carbon ketose sugar. We can number the carbon atoms as shown below. figure 1 The…
Q: Calculate the number of moles of ATP produced from the complete oxidation of 900 g glucose in the…
A: Glucose that enters the cell produces ATP by respiration. The processes involved are glycolysis,…
Q: D-Talose is a C2 epimer of D-galactose. Using the Fischer projection structure, draw the product of…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: po Which of the following non-covalent interactions is the driving force in the initial…
A: A protein's function depends on its structure. There are four levels of protein structure: primary,…
Q: Which enzyme catalyzes the following reaction?
A: MM kinetics relates the initial rate of a reaction with initial substrate concentration when the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- 6. Consider the following proteins to answer the questions below: Protein Size (kDa) pl ε at 280 nm 10 4 7000 50 4 14000 10 8 3000 50 8 50000 A B C C Red Colored? Yes No No No b. Describe a two-step purification procedure that could be used to purify/isolate protein A from the other proteins. In your response, describe the type of chromatography used, the pH of buffer needed, and a labeled chromatogram (include absorbances at both 280 and 400 nm). Make sure you note which "fraction/sample" is needed from the first step to proceed/use for the second step. Use another page if necessary.1. In Gel filtration chromatography, when will you stop collecting eluents if sample is not colored? 2. How does SDS-PAGE separate proteins and peptides from each other? Explain. 3. Explain the Donnan Membrane Phenomenon. Why is it important for the homeostasis of the cell?3) What specific proteins might be targeted for up- or downregulated adsorption when designing an implantable material? Please list at least two for each.
- 14. A protein mixture consisting of proteins A, B, and C was subjected to various protein purification steps. First, the protein mixture was applied to an anion ion exchange column. When the column was washed with an increasing concentration gradient of chloride ions, the order of elution of the three proteins was B, then C, and finally A. Next, the protein mixture was chromatographed on a gel filtration column. The order of elution of the three proteins from this column was C, A, B. Finally, the protein mixture was passed over a chromatography column containing a Ni-NTA affinity matrix. Only protein A was retained by the column. Answer the following (i) Which protein (A, B, or C) has the highest and lowest positive charge (ii) Which protein has the highest and lowest mass (ii) Which protein has an affinity for the Ni-NTA matrix and why2. Assuming that you will need to include osmotic shock as one of the steps, calculate the maximum osmolarity (osM) of the solution you would use to break E. coli apart. Assume that the internal ionic strength of the cells is 0.41 osM and that 5 atm is sufficient to rupture the cells, after the necessary treatment steps you mention above in (1). Assume room temperature of 25 °C.4. The table below describes a procedure in preparing standard solutions of a protein sample with different concentrations. (A) Determine the concentrations of each tube if the starting concentration of the protein is 500 mg ml (B) Determine the equation of the line if the concentration (x-axis) was plotted vs the absorbance (y-axis). (C) What is the concentration, in mg ml of the diluted unknown protein sample if the absorbance at 595 nm is 0.333? Tube Volume of protein, Volume of water, Final concentration, Absorbance mL mL mg ml [at 595 nm) 1 0.00 5.00 0.113 2 0.70 4.30 0.184 3 1.40 3.80 0.251 14 2.10 2.90 0.329 2.80 2.20 0.385 3.50 1.50 0.454 7 4.20 0.80 0.503 5.00 0.00 0.577
- 1. You want to purify a protein using anion exchange column chromatography. In this technique, the solid state beads are positively charged. What charge would you want your protein to have in order for it to "stick" to the beads? Neutral Positive Negative 2. In your anion exchange experiment, your protein of interest has a pI of 6.0. Which of the following buffer solutions would you want to use when loading your protein extract onto the column so that your protein "sticks" to the beads? pH 4.5 pH 7.3 pH 6.0 3. You want to analyze your chromatography results using gel electrophoresis. If your protein is a pentamer consisting of 2 alpha subunits, 1 beta subunit, and 2 gamma subunits, how many bands would you expect to see on your gel? The alpha subunits are 32kDa. The beta subunit is 32kDa. The gamma subunits are 15kDa. 1 5 2 3 4. You want to analyze your chromatography results using gel electrophoresis. If your protein is a pentamer…Consider the following properties of the protein components of a sample mixture as provided in the table below. Protein Molecular IpH Percentage of polar amino acid residues Weight (kDa) (%) АСЕ 200 7 20 CLU 25 65 DIA 100 10 40 НЕА 50 807. Imagine that the red blood cells shown below are suspended in liquids of 3 different concentrations. a. Identify the solution in each box as either hypertonic, hypotonic, or isotonic. b. Describe the reasons for your choice of tonicity. Solution 1 2 3 Red Blood Cells Top-Down View Side View Tonicity of Solution? Reasoning?
- 7. The diffusion constant for the membrane protein fibronectin is approximately 0.7 x 10-12 cm²/sec, whereas that for rhodopsin is about 3 x 10-9 cm2/sec. Calculate the distance traversed (in nanometers) by each of these proteins in 50 msec.3. Osmosis is also part of the colligative properties of a solution. This time, we are going to relate it using the red blood cells and the different types of solutions namely hypertonic, hypotonic and isotonic solution. Answer the following questions: a. What is the movement of solute particles in osmosis? b. What happens to the sizes of the following red blood cells with the different types of solutions? i. Hypertonic solution ii. Hypotonic solution_ i. Isotonic solution 4. Enumerate at least 3 – 5 practical applications of colligative properties in everyday lives1. Working as an engineer in the R&D section of a biotech industry, you are asked to select a membrane to concentrate a solution containing a protein with a molecular weight of 200 kDa; Fortunately, it has three types of membrane in the cellar: one for MF, one for UF and one for RO. Which one would you choose to perform the required service? Could you establish some characteristics of the chosen membrane?