Answer all pf them function and in the same way need to be answered! 39.7Engen ForldE. divinacmambil eller 0069membidnoiaNisminAdosione?Function:In the same way...oled elds er Function:ed insiq & ilsIn the same way...ollensproAPPFunction:In the same way...Function:In the same way... Complete the table below. For each organelle, indicate whether it is found in an animalcell, a plant cell, or both. Create a nickname for each organelle that is connected to theorganelle's function and explain your decision.RibosomeGranulasOrganelleCristaeLungTEIntermembrane spaceMatrixATP synthase particles1/1/0 RDInner membraneOuter membraneDeoxyribonucleic acid (DNA)Animal/Plant/BothNicknameExplanationFunction:In the same way...Function:In the same way...

Cell, in biology, the basic membrane-bound unit that contains the fundamental molecules of life and…

Answered: 2. divin asambl ellergro .noia NisminA…

2. divin asambl ellergro .noia NisminA desione Function: In the same way... woled aldo Function: 190 Insig G In the same way... ollenspro *** Function: In the same way... Function: In the same way...

Essentials Of Human Development

1st Edition

ISBN:9781285647357

Author:Kail

Publisher:Kail

Chapter4: The Emergence Of Thought And Language: Cognitive Development In Infancy And Early Childhood

Section4.3: Mind And Culture

Problem 6TY

See similar textbooks

Related questions

Q: Which pair shows endoparasites? a.)tick and mosquito b.)tapeworm and leech c.)leech and flea…

Q: How can you tell dense regular connective tissue and smooth muscle tissue apart under the microscope

A: Introduction A group of cells organized together to perform a specific function is called a tissue.…

Q: What are the most common benign bone tumors of children?

A: Bones are the important tissues of the body which give a structural framework to the body. The long…

Q: Which of the following statements does NOT correctly describe the role of inhibin in the male…

A: Introduction :- The biological system made up of all the anatomical organs involved in sexual…

Q: What structures are affected in cleft palate and cleft lip?

A: Cleft lip and cleft palate appears as a split in the lip and roof of the mouth. This condition…

Q: In the tropical savanna, the climate is hot but with abundant water. In the Willamette Valley, the…

A: C4 plants are more efficient than C3 due to their high rate of photosynthesis and reduced rate of…

Q: 3. Give the genetic content and chromosome number (n) of a diploid cell during the following phases:…

A: Mitosis is the cell division process that involves production of two daughter cells that are…

Q: Which reflexes inhibit intestinal motility? Which promote it?

A: Reflexes are involuntary actions to certain stimuli. The intestinal reflexes are used for the…

Q: Table below presents the criteria to be used in comparing mitosis and meiosis. Provide the missing…

A: Cell division occurs in two stages: mitosis and meiosis. mitosis, the process of creating new body…

Q: identify which substrates are most compatible for L929 cell growth. Support answer with…

A: L929 is a fibroblast cell line derived from a clone of male C3H/Anmouse subcutaneous areolar and…

Q: B. Draw and label the cross section of the cat ovary (using HPO). Label all the oogenic cells. C.…

A: The organs of female reproductive organs produce female sex cells that are egg cells or ova. There…

Q: phase best describes the major process compon evolution? natural selection O adaptation O survival…

A: Ans: Charles Darwin the British naturalist gave the theory of biological evolution. He defined…

Q: How has MRSA changed musculoskeletal infections in children?

A: MRSA-related musculoskeletal infections are frequent in osteomyelitis and septic arthritis.…

Q: TRUE OR FALSE: Digestive secretions from the small intestine complete the digestion of…

A: The long, narrow and coiled part of elimentary system that starts just below the stomach, where both…

Q: is a substance secreted by cells in the lungs that reduces surface tension.

A: The alveoli are the tiny air sacs in the lungs where gas exchange happens. And there Walls are lined…

Q: Don't copy

A: We know that The blood circulatory system and lymphatic system are highly connected with each other…

Q: In dioecious plants, males usually produce larger flowers that attract more pollinators than do…

A: Answer: Dioecious plants : These are the plants which are having only either female reproductive…

Q: By what mode of cell division would you expect sperm cells to be formed in the haploid male be?…

A: Introduction: The process of sperm cell formation is called spermatogenesis. To create spermatozoa,…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: Which of the following describes the effect of the venom on the prey of the cobra?

A: Introduction Muscle contraction is a result of action potential generated by depolarization,…

Q: R8

A: We know that Hormones are defined as the type of signaling molecules that are directly secreted into…

Q: o (8) a. Which one of the following phenomena is responsible for transportation of food through…

A: Cell is the smallest functional and structural unit of life. Each cell perform their specific…

Q: Discuss the clinical manifestations of Duchenne muscular dystrophy.

A: Duchenne Muscular Dystrophy( DMD) Children may have difficulties walking or rising from a seated or…

Q: List the events occur at the neuromuscular junction.

A: Introduction The NMJ or the neuromuscular Junction is the site of synaptic connection between the…

Q: How does cellular respiration demonstrate an energy transformation? The carbon from glucose is…

A: Introduction Cellular respiration is a metabolic pathway that involves the breakdown of complex…

Q: What is the ultimate cause of variation in populations?

A: Genetic Variation in population Genetic variation refers to differences in the genetic makeup of…

Q: The two major patterns proposed by Darwin are: 1) species change over time, and 2) species give rise…

A: Charles Darwin was a British naturalist who proposed the theory of natural selection in biological…

Q: 14. Other than bacteria list the other 6 types of Microorganisms listed in your textbook.asap

A: We know that Microorganisms are the smallest life forms on our planet. They are not visible from our…

Q: A Senecio lautus population growing on a headland has a prostate form, growing low to the ground,…

A: A Senecio lautus is a flowering plant species in the daisy family. The two main populations of this…

Q: How can one confirm/investigate the type of inhibition exerted by azt on the hiv reverse…

A: 3'-azido-3'-deoxythymidine (AZT) is a Thymine analogue. It inhibits HIV reverse transcriptase by…

Q: What step in the scientific method follows experimentation?

A: Introduction The scientific method of research is a process that involves various steps of…

Q: Genotype frequencies from two diploid populations are estimated from a genetic marker with two…

A: Genotype frequency refers to the frequency or percentage of a particular genotype in a given…

Q: Transport proteins have been found in all biological membranes. What hypothesis could you make…

A: Transport proteins are found in the membranes of all cells and are responsible for moving molecules…

Q: Define the differences between tendons and ligaments.

A: Introduction To maintain the proper shape, structure, and integrity of the body, specialized tissue…

Q: When the mammalian brain compares the actual temperature of the body to the preferred temperature of…

A: The cerebrum, brainstem, and cerebellum make up the brain. It is in charge of the majority of the…

Q: Which of the following is not a correct description of tissue pathology? Neurilemmoma is a very…

A: Introduction: Diagnosing and characterizing neoplastic and non-neoplastic illnesses of the soft…

Q: Give two possible reasons (hypotheses) why pest control specialists experience fewer fatalities from…

A: Pest control specialists have more contact with stinging insects than the general public, but they…

Q: Compare herpes zoster and varicella.

A: Herpes zoster is just another name for shingles. The varicella-zoster virus causes both shingles…

Q: What are ribosomes? State the function of ribosomes. In what way eukaryotic ribosomes differ from…

A: A subfield of biology called cell biology examines the composition, operation, and behavior of…

Q: 4. Use what you know about the anatomy and physiology of special sensory organs to evaluate how each…

A: we will be discussing how different changes in an animal's anatomy and physiology can impact its…

Q: Five dialysis bags, impermeable to sucrose, were filled with various concentrations of sucrose and…

A: Five dialysis bags with varying sugar concentrations are provided. However, the bag's membrane is…

Q: Besides agarose gel electrophoresis, there is also SDS-PAGE (sodium dodecyl sulphate- polyacrylamide…

A: To separate DNA, RNA, or protein molecules according to their size and electrical charge, a…

Q: What is the difference between Becker and Duchenne muscular dystrophies?

A: Muscular dystrophies are genetic disorders. It affects the muscles and gradually destroys the…

Q: The key feature that distinguishes alternation of generations from other life cycles is O a distinct…

A: Introduction Alteration of generation is a life cycle of plants that involves two different phases…

Q: Which of the following is true about the immune system? Check all that apoply. Rejecting organs or…

Q: What would be the effect on flowering time of over-expressing VIN3 (i.e., 35S:VIN3) in a winter…

Q: How do the skin blood vessels and sweat glands regulate body temperature?

A: The skin blood vessels regulate body temperature by- During hot climate or when the heat is more…

Q: Describe the two layers of the skin.

A: Skin is the largest external organ of our body that forms a external protective layer and protects…

Q: Supposed mitotic and meiotic had never evolve. What do you think would have been the consequences?…

A: Mitosis and meiosis are cell division proces. Mitosis results in cloned cells while meiosis makes…

Q: How could control of the glow trait be ultimately determined?

A: Introduction Genes are the hereditary units present on the chromosomes, these genes encode specific…

Concept explainers

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.

Question

Answer all pf them function and in the same way need to be answered!

39.7
Engen Forld
E. divin
acmambil eller 0
069
membid
noia
NisminA
dosione?
Function:
In the same way...
oled elds er Function:
ed insiq & ils
In the same way...
ollenspro
APP
Function:
In the same way...
Function:
In the same way...

Complete the table below. For each organelle, indicate whether it is found in an animal
cell, a plant cell, or both. Create a nickname for each organelle that is connected to the
organelle's function and explain your decision.
Ribosome
Granulas
Organelle
Cristae
LungTE
Intermembrane space
Matrix
ATP synthase particles
1/1/0 RD
Inner membrane
Outer membrane
Deoxyribonucleic acid (DNA)
Animal/
Plant/Both
Nickname
Explanation
Function:
In the same way...
Function:
In the same way...

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

15) Examine the diagram of a reflex arc shown below. In this case, pain from tissue damage to the hand results in a response where muscles move the hand away from the painful stimulus. ST. gridld.doi vd ehow or2 1o notelvib dot Figure 38-10 Biology; Life on Earth, 8/e © 2008 Pearson Prentice Hall, Inc. barostin 20 a) On the diagram above, label the motor neuron, the sensory neuron, the interneuron, and the effector. b) List any way or ways in which the nervous system will determine the intensity of the pain the example above. Corobral cortex
Read this article (http://openstaxcollege.org/l/strokespell) to learn about a teenager who experiences a series of spells that suggest a stroke. He undergoes endless tests and seeks input from multiple doctors. In the end, one expert, one question, and a simple blood pressure cuff answers the question. Why would the heart have to beat faster when the teenager changes his body position from lying down to sitting, and then to standing?
Watch this video (http://openstaxcollege.org/l/3Dmovies) to learn about the side effects of 3-D movies. As discussed in this video, movies that are shot in 3-D can cause motion sickness, which elicits the autonomic symptoms of nausea and sweating. The disconnection between the perceived motion on the screen and the lack of any change in equilibrium stimulates these symptoms. Why do you think sitting close to the screen or right in the middle of the theater makes motion sickness during a 3-D movie worse?
In 2003, the Nobel Prize in Physiology or Medicine wasawarded to Paul C. Lauterbur and Sir Peter Mansfield fordiscoveries related to magnetic resonance imaging (MRI).This is a tool to see the structures of the body (not just thenervous system) that depends on magnetic fields associatedwith certain atomic nuclei. The utility of this technique inthe nervous system is that fat tissue and water appear asdifferent shades between black and white. Because whitematter is fatty (from myelin) and gray matter is not, theycan be easily distinguished in MRI images. Visit the NobelPrize website (http://openstaxcollege.org/l/nobel_2) toplay an interactive game that demonstrates the use of thistechnology and compares it with other types of imagingtechnologies. Also, the results from an MRI session arecompared with images obtained from x-ray or computedtomography. How do the imaging techniques shown in thisgame indicate the separation of white and gray mattercompared with the freshly dissected tissue…
what are the differnce between T1 and PD in MRI imaging?
PA Tupnu u ow nh8 The jaom od Figure 38-10 Biology; Life on Earth, 8/e © 2008 Pearson Prentice Hall, Inc. a) On the diagram above, label the motor neuron, the sensory neuron, the interneuron, and the effector. b) List any way or ways in which the nervous system will determine the intensity of the pain in the example above. 12) 12 TO
What is propriate functional autonomy? Describe three principles that govern propriate functional autonomy.
TION: 80 Minute Timed PX с d r J ura 3 →1 58 59 60 61 62 63 64 esc 65 66 67 68 69 70 Quizzes 2 rutgers.instructure.com/courses/207533/external_tools/retrieve?display=full_width&url=https%3A%2F%2Frutgers.quiz-Iti-iad-prod_ O O O X Previous 53 1 point The limbic system is a region of the brain referred to as the "emotional brain" and is made of the following: A-thalamus, hypothalamus B - hippocampus, hypothalamus C- amygdala, olfactory bulb A and B are correct B and C are corrrect A, B, and C are correct + C 01:01:03 Time Remaining % MacBook Pro G Search or type URL ☆
Aphasia, in particular, has very scattered results and progress. what sort of things affect the expectations on progress? are ther ways to increase the effectivness of the therapy(techniques, timing, focus)?
Discuss the concept of thought-controlled input devices and their potential in medical applications and assistive technology. What ethical considerations arise when using thought-controlled devices?
1.) What is the general understanding of biological processes, including depolarization, nerve impulse transmission and synaptic transmission 2.) what is integrating a sense (ie. vision hearing etc.) into knowledge of reflex arcs and then arranging the events in order they would occur 3.) how an external substance would change the distribution of ions in a resting membrane and alter the electrochemical response 4.) identifying the names and locations of glands th
So named beacause it acts under conscious control?