16. In amphibian embryos, BMPS act on ectodermal cells in concert with Wnts to form the epidermis. What happens to ectoderm when both BMP and Wnt inhibitors are active?
Q: Continuing from the question above. You are able to correctly modify the blood stem cells and return…
A: Sickle cell anemia is majorly due to missense mutation which results in valine substitution in place…
Q: Which form of flavin adenine dinucleotide is the "reduced" form, FAD or FADH2? Explain
A: Flavin Adenine Dinucleotide: It is a redox active coenzyme associated with various proteins, which…
Q: Based on the Cytochrome C data, which organism is most closely related to humans? 2. Do any of the…
A: Answer
Q: Pyruvate kinase, a glycolysis enzyme
A:
Q: Explain why this statement is true, using phylogenetic and morphological evidence. Tunicates…
A: Tunicates are transparent or brilliantly colored marine animals that are found on the dock pilings,…
Q: Marie diluted her phage lysate from 10° to 109. She completed the titer assay protocol using these…
A: This question is about dilution.
Q: 3. Frank weighs 112 kg and John weighs 56 kg. Both are exposed to 5 may of gamma radiation. Do they…
A: Gamma rays are the highest-energy electromagnetic radiation with the shortest wavelength. The…
Q: You are developing a anti-viral treatment for SARS-CoV-2. You decide to have your product target the…
A: The SARS-CoV-2 virus causes Coronavirus Disease (COVID-19), an infectious disease. The following are…
Q: What cellular event happens in response to the binding of a growth factor to its respective receptor…
A: As per our company guideline we are supposed to answer only first question or first 3 subparts of…
Q: 2
A: The ovary is part of the female reproductive system. It is an organ that has ova (eggs). These ova…
Q: You are studying a pathogenic bacterium which secretes a toxin that affects G protein receptor…
A: The cAMP signaling pathway, commonly referred to as the adenylyl cyclase pathway, is a cell…
Q: A human liver has how many autosomes from the father? a. 46 b.23 c. 22 d.2 e. 1
A: Nucleus is a main controller of the cell which comprises of thread like structure known as…
Q: If the G locus were 50 or more map units from the centromere, what types and proportions of gametes…
A: Introduction Recombination:- It is a process by which pieces of DNA are broken and recombined to…
Q: Nonrecombinent phenotypes: Female/males with gray body/red eyes; females/males with yellow…
A: GIven: Recombinant genotypes are forme by linked genes and their ocmbinations where these…
Q: Directions: Based on the analogy of light reactions. Describe the pattern of the electron flow…
A: The initial phase of photosynthesis is the light reaction, that converts sunlight into chemical…
Q: Which of the following things is/are true about this organism? invertebrate chordate fish Agnathan…
A: The Arctic lamprey is a little fish that can grow to be over 15 inches long but is usually much…
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: marine-plastics-pollution suluton in a
A: Pollution is the introduction of any material (solid, liquid, or gas) or form of energy (such as…
Q: Enumerate the modern classification system of how organisms are classified from GENERAL to SPECIFIC…
A: The modern classification is basically the Linnean system. The whole classification starts with the…
Q: Who was the first to observe microorganisms with a microscope? Crick Pasteur Koch Van Leeuwenhoek…
A: organism that can only be seen under a microscope Bacteria, protozoa, algae, and fungi are examples…
Q: Crop Rotation - B. Pastoral Nomadism –
A: A. Crop Rotation- The practice of planting different crops sequentially on the same plot of land to…
Q: 12. When 2 unpalatable or harmful species mimic each other, this is called? a. Mertensian mimicry .…
A: In evolutionary biology, mimicry refers to an organism's developed likeness to another thing, most…
Q: laborate the advantage and disadvantages of Nano-Plant Growth Regulator
A: Plant growth regulators are the substances that support the growth of plants and are being applied…
Q: Differentiate the following * PEP RuBisCO carboxylase photorespiration fixes aids is appreciable CO2…
A: Answer
Q: What is biomass
A: Biomass is defined as the total quantity of plants in a particular area.
Q: 7. A worker receives a dose of 7.8 mGy to his lungs from an inhaled al- pha emitter, and a uniform,…
A:
Q: Discuss how the structural/chemical properties of fat affect its physical characteristics and…
A: Fats are one of the major dietary requirements for an organism apart from carbohydrates and proteins…
Q: The following items are usually found in non-natural or synthetic cosmetic ingredients. Define each…
A: Antibiotics are antibiotics that are used to treat and prevent infections caused by bacteria.…
Q: In most populations, population size remain near the carrying capacity as long as limiting factors…
A: Limiting resources are considered as the carrying capacity for any population.
Q: (1) List and briefly explain four methods of studying an E-S complex. 2) (a) Which fluorogenic…
A: Answer :1 four methods of studying enzyme substrate complex are : 1.the substrate and the enzyme…
Q: Dinitrophenol (DNP) is a lipid soluble H+ binding drug that equalizes the H+ concentration across…
A: dinitrophenol is essentially an organic molecule with the formula HOC6H3(NO2)2. It's a pleasant,…
Q: Short Answer 4. You identify two recessive mutations in fruit flies, one that results in curly wings…
A: The chi square (x2) analysis is perform to compare the observed data with expected data. In…
Q: 2) Now you would like to raise antibodies to this protein of YFG. How could you use the pure protein…
A: Antibodies generate by the immune system in body against the antigen which is foreign particle…
Q: The a-adrenoceptors are subdivided into two subgroups, a1 and a2, based on their response to the…
A: Adrenorecepors are also known by the name of adrenergic receptors. These are divided into two…
Q: If a person has one gene influencing blue eyes but actually has brown eyes, blue eyes must be a…
A: Introduction :- When two or more genes control the same trait, it is known as polygenic inheritance.…
Q: create a single illustration that will interrelate or link the two opposing pathways, the…
A: Answer :- The glycogenesis synthesis of glycogen from glucose in liver and muscles is known as…
Q: 1. For the complete metabolism of 2 glyceraldehyde 3-phosphate molecules through glycolysis,…
A: Glycolysis is the process in which one mole of glucose is partially oxidized into two moles of…
Q: Please answer fast and all question other wise I will give downvote. QUESTION 1 Why is cancer a…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: Question 3 The extinction rate today is greater than O less than O the same as the background rate…
A: 1. In the equator, species diversity is greater than at the poles. The variety of species rises from…
Q: 1. Base on the graph below, why might the sex ratio of bird species in the figure change from as…
A: Juvenile involving young people who are not yet adults . In the birds the frequency change from…
Q: Automatic responses are processed in more primitive areas of the brain, such as the amygdala,…
A: Amygdala Amygdala is a group of almond shape celled located at the base of the the brain.
Q: 5
A: Answer cat ovary with labelling
Q: Explain why it is not always a good idea for an elderly person to lose weight, even if they have a…
A: Body mass index (BMI) is a screening tool that measures the ratio of your height to your weight.…
Q: Protein N, normally inactivates a tumor suppressor protein. Consider a cell with a mutation in one…
A: For tumour suppressor gene to be purely dysfunctional and leading to neoplastic genes, there need to…
Q: 5. What happens to the population density in a declining po a. It decreases. b. It increases. c. It…
A: Population density can be calculated by three different methods they are arithmetic, physiological…
Q: senescence
A: Definition of Senescence: The process of gradual eradication of functional characteristics in living…
Q: Where would the repressor be bound in an E. coli cell (nonmutant) that is NOT growing in lactose? O…
A: In E. coli, lactose is the substrate for the enzyme beta-galactosidase and it regulates the…
Q: What are the principle and basic concepts of SHAEFFER-FULTON METHOD? (please explain it thoroughly…
A: Answer
Q: LDL LDLR LDLR LDLR ( Which mouse has higher blood cholesterol between mice in lanes 1 and 2?…
A: Western blot : It is a technique used to identify and locate proteins based on their ability to…
Q: Describe the three domains of a receptor tyrosine kinase. Explain the structure of the…
A: Receptor Tyrosine kinase are the most effective high affinity cell surface receptors that acts for a…
Step by step
Solved in 2 steps
- 1. What would be the effects if metamerism is absent in annelids? 2. Account for the variety of environment occupied by annelids and relate them to their morphological and physiological adaptations.6) In the cnidarians, Choanocytes, the cells responsible for filtration, are located in the ectoderm. The cnidocytes, located in the endoderm, are the cells specialized in capturing prey. Cnidocysts, located in the ectoderm, are the cells specialized in prey capture. Choanocytes, located in the ectoderm, are the cells specialized in prey capture. The cnidocytes, located in the ectoderm, are the cells specialized in prey capture.4. The Malpighian tubules of insects grind food into find particles before it goes to the hind-gut have ostia around the outer edge are functionally equivalent to the vertebrate kidney secrete juvenile hormone are found in the mesothorax 5. Lepidoptera caterpillars differ from sawfly caterpillars by having more prolegs by having parthenogenesis in many species by having a pair of stemmata rather than multiple stemmata on each side by being crochets on their feet in movement through looping for some family 6. Hemipterans are also known as book lice have piercing and sucking mouthparts are hexapods are endopterygotes include aphids, scale insects and earwigs
- 1. In Deuterostomes, nutrient molecules (monomers) are taken into the space between the endoderm and the ectoderm because a) the ectoderm makes protein for movement, b) the endoderm cells release hydrolytic enzymes that act on polymers, c) the endoderm releases enzymes that carry out dehydration synthesis of proteins. d) mRNA polymerase causes transcription. e) all are correct. 2.The Amoeba cell exhibits specialized abilities that enable it to react to a stimulus by producing a response or a behavior. It can do this because it has adapted properties exhibited by simpler more primitive cells. These cellular properties include a) Separation of the fluid environments inside and outside the cell. b) Active transport of Na+ out of and K+ into the cell, c) diffusion of Na+ in to and K+ out of a cell in reaction to a stimulus, d) the stimulus interacting with a receptor site in a membrane embedded protein, e) All of these are true.54. In protostomes and deuterostomes, the space between the endoderm and the ectoderm is important because: a) it provides a perfect environment that can be maintained for all the cells even if the outside environment change b) protostomes use their ectoderm to develop digestive organs inside it c) deuterostomes develop their brain from the mesoderm in this space d) the endoderm forms the immune system in this space, e) all are important.-4. In the diagram below, the stages of development in a frog embryo are NOT arranged in the correct order. In what order should they be placed to show the normal sequence of development in the embryo? What process is occurring in this diagram? B. D Dorsal lip of blastopore Dorsal lip of blastopore Dorsal lip of blastopore Dorsal lip blastopon
- 8. The major event in the embryonic development of animals that results in a layered embryo is called Group of answer choices choanoflagellation transmogrification ecdysis compartmentalization desagellation gastrulation gelatinization cephalization1.What is the relationship of prolactin to hatching egg naturally? 2.What is the relationship between relative humidity and temperature inside the incubator compartment? 3.How does relative humidity effect embryonic devslopment? 4.What will happened to the developing embryo if all vents in the incubator are closed?why?Which of the following is true about Sea urchin blastula formation and fate map? a) ectoderm that develops into the larval skin and neurons, is regularly produced by the vegetal half of the embryo. b) an1 layer generates cells that can enter either the ectodermal or endodermal organs of the larva. c) veg2 layer forms the endoderm, coelom (internal mesodermal body wall), and the non- skeletogenic mesenchyme. d) small micromeres differentiate into the PGCS e) large micromeres differentiate into the secondary mesenchyme cells
- O potassium ions O sodium ions Question 18 In sea urchins, which of the following pairs of events most directly results in the short-lasting "fast block" and the longer-lasting "slow block" to polyspermy, respectively? O formation of the jelly coat and the vitellin membranes O the cortical reaction and the formation of yolk protein O the acrosomal reaction and vitellogenesis O membrane depolarization and the cortical reaction Question 19 Which of the following correctly describes a difference between the vegetal pole of a frog zygote and the animal pole? O The blastomeres originate only in the vegetal pole. O The vegetal pole has a higher concentration of yolk. O The polar bodies bud from this region. The vegetal pole cells undergo mitosis, but not cytokinesis. 11.State the functions of each egg part 2. What are the roles of the egg in animal development? 3. What about in plants, what is the counterpart of egg in plants? Why? 4. Compare between again and reptilian eggs.1. Define sessile. Name an invertebrate with a sessile adult stage. 2. Sponges have specialized cells called collar cells. Describe how collar cells are specialized for the functions they serve. 3. What is a nematocyst? What is its function? 4. How do coral reefs form? 5. How do free-living nematodes contribute to the carbon cycle? 6. Describe the basic body plan of a mollusk. 7. What are gills? What is their function?