12. How do bacteria move around? What is chemotaxis? Phototaxis? What are bacterial H-antigens? Can flagella be arranged in different ways on different bacterial species? Is the bacterial flagellum constructed the same way as the eukaryotic flagellum or are they completely different tуpes of structures?
Q: 1. Does candida famata yeast from animal meat can cause diseases when person ate that contaminated…
A: Yeast can be referred to as eukaryotic organism that possesses single cell. It can be categorized…
Q: 3.In an experiment, two culture plates of the same bacteria were exposed to UV light for the same…
A: * Given that two Bacterial cultures were exposed to the uv light for same amount of time *…
Q: 9-What group of antibiotics interferes with the DNA-replicating enzyme DNA gyrase? 10-How do azoles…
A: Introduction: Azole antifungal drugs can be used to treat athlete's foot, onychomycosis (fungal nail…
Q: What are the key organelles in a cell?
A: Hello. Since your question has multiple parts, we will solve first question for you. If you want…
Q: 8) Name the three basic shapes of the bacteria in the picture to the right. А B
A: Bacteria are classified as cocci, bacilli, spirilla, and vibrios based on their shape. MreB is a…
Q: 12. The identification of bacteria by serolo gic tests is based on the presence of specific…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: Explain how the overuse of antibiotics promotes resistance in a population of bacteria.
A: Introduction : Microbes that have developed resistance to the majority of antibiotics and antiviral…
Q: 1. What name is given to the process of endospore formation in a bacterial cell? 2. How long is…
A: Introduction Endospore formation is usually triggered by a condition of starvation, especially the…
Q: 1. Explain the difference in coccus, bacillus, and spirillum in terms of their shapes. 2. Are…
A: Coccus Bacillus Spirillum Any bacterium or archaeon with a spherical, ovoid, or generally round…
Q: 1. What is host resistance in bacteria? 2. What is gram staining technique? 3. Difference between…
A: 1. A bacteriophage is a virus that can infect a bacterium and can live inside a bacterium as a…
Q: 1. What is metamerism? 2. What role do leeches play in the field of medicine?
A: In animal kingdom, metamerism seen in annelids, arthropods, etc. Metamerism has a different type…
Q: 1. identify the mycobacterium and staphylococcus, elaborate them and describe the shapes of it (you…
A: Bacteria are single-celled organisms.
Q: 1. Illustrate the cell envelope for gram-negative and gram-positive bacteria.
A: Bacteria is a prokaryotic organism. They are unicellular and devoid of a true nucleus. That is their…
Q: 4. When is it terminal to take an antibacterial after acquiring the bacteria?
A: Antibacterial are low molecular agents that will inhibit the bacterial growth .Since antibiotics…
Q: gram stain, if the bacteris are purple in color, then its
A: Gram staining- This test differentiate the bacteria into Gram Positive and Gram Negative Bacteria,…
Q: 6) explain to me 2 mechanisms organism can use to reverse this VU-caused damage. Give me the step by…
A: UV radiation causes mutation in the DNA of organisms. They can cause dimerization of nucleotide…
Q: 2. What cell structure make Mycobacteria particularly virulent and how? 3. What cell structures do…
A: 2.Tuberculosis (TB), brought about by the intracellular microbe Mycobacterium tuberculosis, stays…
Q: 3. Label the following elements of the figure below: lysogenic phage, lysogenic cycle, lytic cycle,…
A: Introduction The lag phase, the log phase, the stationary phase, and the death phase are the four…
Q: Compare and contrast the cell walls of Gram-positive, Gram-negative, acid-fast, archaea, and…
A: Introduction A cell wall is a structural layer found just outside the cell membrane that surrounds…
Q: 7. What is unusual about prions compared with viruses or bacterial pathogens that makes them so…
A: Thank you for the question Answer :- Prions are harmful proteins that are found in the brain.…
Q: _________4. It is a bacterial that contains plasmid use to produce desirable proteins for human…
A:
Q: 3. Construct a table to compare and contrast Gram positive, Gram negative, Acid fast, and Mycoplasma…
A: Characteristic Gram-positive Gram Negative Acid-fast Mycoplasma Cell wall structure A complex…
Q: Explain how do bacteria infect its host.
A: Bacteria (sometimes referred to as germs) are microscopic organisms that are invisible to the naked…
Q: ) Which cell shapes are observed in members of both Bacteria and Archaea? Which are unique to…
A: Bacteria and Archaea : Theses are small organisms and prokaryotic in nature . The general cell…
Q: are the adsorption mechanism of activated carbon on antibiotics? 3. What will happen to the…
A: Inside a cell, a biochemical process is the transformation of one molecule into another. Enzymes,…
Q: 1. If your body contains so many bacteria, why do they not make you ill?
A: Our body contains millions of microorganisms since birth to adult life . Majority of bacteria…
Q: 7. In 2005 a typhoid outbreak in Delmas, South Africa., prompted the widespread testing of food and…
A: Typhoid- Typhoid is an illness caused by infection with a specific bacteria called salmonella typhi.…
Q: 1)What's Trichomoniasis, name the causative agent. how it can be transmitted, causes and symptoms?
A: Since we only answer one question at a time, we’ll answer the first one. Please resubmit the…
Q: 3. Explain about Peptidoglycan in Gram-negative cell wall
A: Bacterial cells are always bounded by a chemically complex cell wall .The cell wall protects…
Q: 1. Contrast the terms thermal death time and decimal reduction time, and how would the presence of…
A:
Q: 6. Why is silver nitrate used in cauterization of wounds?
A: Cauterization is a medical technique used to remove or close off a part of it. Silver nitrate is…
Q: 8. Salmonella has genes that allow it to survive acidic conditions like the stomach acid and the…
A: Salmonella enterica is a pathogenic bacteria,it evolves a specialized strategy to survive and…
Q: 1) Which of the following apply(ies) to Bacillus cereus and Bacillus anthracis? Choose all that…
A: Bacillus is a genus of Gram-positive, bacilli, or rod-shaped bacteria. B. anthracis is the causative…
Q: 1.Within a 3-day period at a large hospital, five patients undergoing hemodialysis developed fever…
A: Bacteria are prokaryotic organisms that may cause harm to human beings. Such bacteria are known as…
Q: Below is an image of bacterial cells. 1. What shape of bacterial cells is portrayed? 2. Are there…
A: Microorganisms have different morphological features which include the size, shape, and…
Q: 1. How do pathogens use glycans to colonize and invade the host?
A: Glycosylation is a process of the addition of glycans to the cell surface to form a glycoconjugate.…
Q: What is A term referring to the changeable form of the bacteria? 2. What is the filamentous…
A: 1. A large group of microorganisms, many of which cause disease. germs, microbes, microorganisms,…
Q: What is unique about the glycans found in biofilms?
A: ANSWER;- Glycans have been known to play an important role in metabolic, structural, and physical…
Q: contrast prokaryotic cell and eukaryotic cell 2.contrast a cell of Streptococcus pyogenes with…
A: Cell, in biology, is the basic membrane-bound unit that contains the fundamental molecules of life…
Q: 1. . Using the 3-domain approach of classification, into which domain would you place viruses?…
A: There are three domains of life: Bacteria, Archaea, and Eukarya
Q: 6. a) Some phages infecting bacteria possess the enzyme the bacterial cell wall, allowing the viral…
A: Viruses are the obligate parasite. They can replicate in living cells only.
Q: 5. What are the basic shapes of bacterial cells? What are the basic arrangements? Know the terms.…
A: bacteria are prokaryotic, unicellular microorganisms, which back chlorophyll pigments. the cell…
Q: 4. Describe the differences between the gram positive and the gram negative cell wall. Where is…
A: Answer: Gram Positive Bacteria Gram Negetive Bacteria Gram-positive bacteria have a single…
Q: 2. Staphylococcus aureus divides every 20 minutes. A culture begins with 10 bacterial cells.a) After…
A: The question provides the data for the culturing of Staphylococcus aureus (S. aureus) which show…
Q: 12. A student makes a smear by applying a bacteria onto the slide. A simple stain is performed, but…
A: A student makes a smear by applying a bacteria onto the slide. A simple stain is performed, but when…
Q: 13) A certain bacterial colony originated from the division of a single bacterial cell. Each cell in…
A: Bacterial colonies are prepared in order to isolate different strains of bacteria and obtain the…
Q: 3) What is the effect of time on the bacteriocidal effects of UV? The effect of distance?
A: The term bacteriocidal refers to the any compound, method or technique of prevention of growth of…
Q: Which of the following statements is TRUE? A) Fimbriae are generally longer and less numerous than…
A: Prokaryotic cells are simpler than eukaryotic cells. Prokaryotic cells lack nucleus and other…
Q: 1. How is the cell membrane similar to a plastic bag with tiny holes? 2. What two components make up…
A: Since there are multiple questions asked, we will solve only the first three questions. If you need…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- SATestprep, LLC- Online State es/test/tq.php?testid-9848strandid=4936&element=D&assignment id-41828865&load test=18teacherPreview=#test A cellular protesses, maximiZing cIcIency. The ENDOSYMBIOTIC THEORY 3nascond edybee pel, he eady nukarycte ponsuned otosuhetc ngs n the plas membrane t nn ses pokaryote ge me to endonmbe comporen Incluting anuceus ns endpl um baderis roued int Endplaun cke Nudes Phot etic baceriam Modern photosynthetic ukaryote Proto-ukaryote -Meochondrim Atec bacenum Anetredon even te ancesia kaye conumed ae bic bactia fat evoived eto mnodhonca Modern heteotrophic eukanyote The diagram provided shows the evolution of membrane-bond organelles in eukaryotic cells. The Endosymbiotic Theory proposes that the organelles distinguishing eukaryote cells evolved through symbiosis of individual single-celled prokaryotes. Which of these statements provides supporting evidence for the endosymbiotic theory? A) Chloroplasts have a single phospholipid membrane. B) The DNA in…Lab 2 MicrosCO X Copy of Lab 2 X M Inbox (53,887) x b Answered: 4. 1 x C Search Textbo X + /d/1lq1XGTjeDOK-AZLP5NCDYYPZT3K6_fPLnwx-GvHgLnU/edit# Normal text Arial 12 %00 L 1 2 3. 4. 5. 9. Observing Bacteria in Colonies In fresh or saltwater habitats, cyanobacteria will appear (without a microscope) as very small green lines (as can be seen in this video). Observe the following images of cyanobacteria colonies under 100x and 400x magnification with a light microscope: Anabaena sp. 100x magnification Anabaena sp. 400x magnification As you can see, cyanobacteria grow as two different types of cells: those that are photosynthetic (fixing carbon dioxide to make sugars), and heterocysts (that fix nitrogen to make proteins and nucleic acids). Although these cells are genetically identical, each is able to accomplish this via differences in gene expression, a key concept in biology you will continue exploring this quarter. In the 400x magnification image, you should be able to clearly see two…es/_518299_1/cl/outline?customClassicLocation =%2Fwebapps%2FBb-McGraw Hill-BB5744b9beb8ccb%2Fapp%2Flink%2Finbou Edits will not be automatically saved. Save now File Edit Format Tools Help Chapter 7 List Paragra... functions? ● Unsaved ● ● Calibri ● What types of nutrients do microbes require, and where are they obtained? What are the different nutritional types, and where do they obtain their carbon and energy? What are the various types of passive and active transport, and how do they work? How do various environmental factors affect microbes, and how are they classified based on these factors? T 11 Y BIU A - A What are the five ecological associations between microbes, and how do they work? How do microbes grow and divide, and what are the stages of a population growth curve? Chapter 8 What is metabolism, and what are the two general types of metabolic reactions? 0 Mar 12 111 !!! 8:08 A O
- od 1 Meet- zpn-oxtp-bxu Unit 2 test - cells, organelles, mer X G In order to deteminie how cells rx A testing.illuminateed.com/assessment/5f765e7b4c2b2eb5078b7842/5f765e7b4c2b2eb5078b7843/1?rldbqn=1 ail YouTube Maps O News (1) Facebook Launch Meeting - Z... TikTok sues U.S. go... i! Spanish Present Pro... embrane, transport fall 2020 D. Water moves into and out of the cell at the same rate since the cell is isotonic to its environment. 7. In carrying out normal activities, cells use oxygen and produce carbon dioxide. The concentration of oxygen is higher in the blood than inside the cell, so oxygen moves into the cell. Similarly, carbon dioxide moves out of the cell into the blood because the concentration of carbon dioxide inside the cell is greater than the concentration outside the cell. How do the small molecules of oxygen and carbon dioxide move through the cell membrane?8 F ~ A References Aav Po AV nited Kingdom) Mailings Review E EVE la WC7137 - Medical Microbiology REP 21-22 View RCM 24 | Figure 1 D Tell me AaBbCcDdEe Normal 3. A 3-year-old child was brought to the emergency by her parents because of fever and difficulty in rousing her for the past 24 hours. Meningitis is suspected. An image from the Gram staining of the CSF sample is shown in Figure 1. The child was started on IV antibiotics and the fever subsides on Day 1 post-admission. However, fever recurred on the third day post admission. An intravenous catheter associated blood stream infection was suspected and blood cultures were taken. After 24 hours, the blood culture shows the growth of a Gram-positive bacteria. The picture of the culture growth on blood agar is shown in Figure 2. Based on this information, answer the following questions. AaBbCcDdEe No Spacing MacBook Air Aa BbCcDc AaBb CcDdE AaBb Aa Bb Heading 1 Heading 2 Title Su 2. Figure 2 c) Discuss the host-pathogen interactions…Calibri Light (H.. v 11 A BIU ov Av A 2. Are bacteria unit- or multicellular? What about the chains or colonies seen in slides and. ヘ三 diagrams? Explain. A. Bacteria also play a role in the maintenance of healthy ecosystem. They help decompose decaying matter and help digest food in the guts of animals. 3. If a person is diagnosed with syphilis, which bacteria species is most likely the cause? A. Syphilis is usually a sexually transmitted disease, but it is occasionally acquired by direct nonsexual contact with an infected person, and it can also be acquired by an unborn fetus through infection in the mother 4. Think about Clostridium botulinum. Explain the terms below that describe this species. a. Gram-positive b. Anaerobic C. Motile d. Botulism 5. Explain why methicillin-resistant S. aureus (MRSA) is a problem in clinical medicine. 6. Do you see any nuclei in the specimens? What accounts for the colors of the cells? Explain. 7. Explain gram stain method in terms of how useful it is…
- A client has been ordered methyl Pprednisulune 30omg luPB In 30mL D5W Over 15 min.stat fur an asthma att-acis. in Stous,you have methylpredrisolune 500mg vials . The reconstitutiun Instructions are: Add 7.8mL G Sterile uater and shale genly Each reconstituted uial contains 8mL. a) Houw nmuch medieation will you draw up? 6) what is the Infusion rate in mt/ hr ?A elearn.squ.edu.om/mod/quiz/attempt.php?attempt3D1335328&cmid%3D697149 E-leaming System (Academic) estion 19 Which of the following bacteria contain "Endotoxin" as an important constituent of its structure? ot yet swered Select one: arked out of O a. It is present in both O b. Gram positive bacteria Flag question O c. Fungi O d. All answers are correct O e. Gram negative bacteria stion 20 In our bodies, food is broken down into smaller molecules by catalytic enzymes in the digestive tract to allows yet for easy absorption of nutrients by cells in the intestine. vered Oat bran proteins for example, are broken down by pepsin enzyme, by which reaction does this process happen and which chemical bonds will be broken down? ked out of ag question Select one: O a. Dehydration, covalent bonds O b. Hydrolysis, hydrogen bond Oc. Condensation, peptide bods O d. Hydrolysis, covalent bonds O e. Dehydration, hydrophobic interactionsFile guft 1.yt Machine Cochise14ee7 Lane 0 Pmer. DTarPOPD mob Comment 17703 Spacing 15.06 Siga C 17A 4 G 2 Bases 0 an 2004 Gelstat ime123 219 20 30 60 70 NNACTCA TCTOGTGGA TTC CTA TCCTG AC A AG TGATGTG CAAAC TG GTAACTC TG AG GCAGATAAC CA G GG CA AA AAGGTG TATAAG 100 110 140 100 CAGA AG TC CGGA AA A TCA TT TAA 170 TAAA ACA AAGCCCTAACT TG GAAG AAGT TCA GTTTTACACA TCT TTA TA TG GAGAGAA 180 TAT TCTAT TA ATOTCCTGT TA TATT TG TCA TATTCA TA CAGT TGTCACAGTATATT TCAAAC CA AC TG TTTAAAA ACAAAC TO AAATAAA 210 230 240 260 270 AAATTTAAATACCCT TA TG TA AA ATAG GCT TC CC TG GTG GCTCAG GG GTAAAAA ACTCGC CCGC CA ACGCAG GAGATGTAGAT TTGATC CCT 300 310 340 350 410 430 440 GG GT TAG GA AG icCCTa GAGA AGGAAATGAAAAAC CACTCTAG TAT TCT Tac CTG GG AAATC CCA TGGACAG AG GAGCOTO GAG G Gc 490 500 SI0 530 TACAGTCCATGGGAGTCGCAA A AGAGT TG GACATG ACTAA ACA ACAACATATAAAATAACCT TACTC CATAATGTCAAACT TATOTCACAC S40 AAA ATGCAA AGT TCT TACATCTAT TAACTTTTATGOT TAAATATA ACCTAATGCACTOTTT TATACAGCA ACAACTACT TT TT TATTT TAAA…
- SMART ll A Or © X39% 011:23 Q1WK2.docx 团: Biotechnology Quarter 1 Week 2 Name (Surname, First Name, Middle Initial): Section (Program – Grade Level – Section): Mini Home Experiment Materials: o perfume o clean drinking glass o water o tomato/kamatis o ginger o salt O sugar o platito o knife Procedure: Set-up A: 1. Open your bottle of perfume and spray it at one corner of your bedroom. 2. Observe what happens after 15-20 minutes. Questions: 1. What happened after 15-20 minutes? 2. What is the reason behind this phenomenon? Set-up B: (Be careful with the use of sharp objects. ADULT SUPERVISION IS ADVISED) 1. Cut two ginger sticks of the same size. 2. Prepare two drinking glass of the same size and fill it with equal amounts of water. Label them A and B. 3. Dissolve three teaspoon of salt in glass B. 4. Place the ginger sticks separately in glass A and glass B. 5. Leave the set-ups overnight. 6. Observe the ginger sticks the next day. Questions: 1. Which is the control set-up? 2. What did…Font Paragraph Styles 12. What class of Biosafety Cabinet is shown below? C A I Room air Contaminated air HEPA-liltered air Side View8:02 PM A docs.google.com © 11% 4 FALSE TRUE Tne pr tatic creti TL. whi -Wh ubilit .ate The ora ved cll re oce лосе ertili on s ur J ir rura .ure Jid Tme fih , car test vi tion d in sexu sal Interr : loca ey int ce s from s* urc and ar th, si gılals to th motor The E Tne E sit for fr Is lined cliuin & has with ci • penstuiic vvaves The praietal lobe specializes in motor activity, personality, .and speech The scrotum keeps the testicles outside the body so they can be 1 degree cooler than normal core .temperatura The uterus: a thin muscular pouch about the size of an almond that lies in the abdominal cavity posterior to