11a. In class, we discussed the regulation of expression of the Trp biosynthesis enzymes. These are the enzymes that make Trp amino acid. Fill in the following table. Environmental Condition Fed Trp amino acid NOT fed Trp amino acid Which proteins bind to the Trp Promoter ANSWER ANSWER Are Trp biosynthesis enzymes transcribed? (Yes or No) ANSWER ANSWER

11a. In class, we discussed the regulation of expression of the Trp biosynthesis enzymes. These are the enzymes that make Trp amino acid. Fill in the following table. Environmental Condition Fed Trp amino acid NOT fed Trp amino acid Which proteins bind to the Trp Promoter ANSWER ANSWER Are Trp biosynthesis enzymes transcribed? (Yes or No) ANSWER ANSWER

Name: I do not know how to complete it please 11a. In class, we discussed th
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: I do not know how to complete it please 11a. In class, we discussed the regulation of expression of the Trp biosynthesis enzymes. These arethe enzymes that make Trp amino acid. Fill in the following table.Environmental ConditionFed Trp amino acidNOT

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 3VCQ: Figure 16.13 An increase in phosphorylation levels of elF-2 has been observed in patients with...

See similar textbooks

Similar questions

E VG ✓H NA MATEN Match each letter (A through G) to its description. B A ya pada saat ada para a H F காலிமாம்ம் P S —— 1. Receptor 2. RNA 3. Lysosome 4. DNA 5. Ribosome 6. Ligand 7. Kinase domain 8. Nucleus 9. Mitochondria 10. Phosphorylated transcription factor 11. Dephosphorylated transcription factor 12. Plasma membrane
Answer the following 2 questions based on the figure below. The figure represents a ERNA that recognizes and binds a particular amino acid. of Second letter A UUUphe UAU UACTy UAA Stop UGA Stop A UAG Stop UGG Trp C UGU UccJCy UCU UUCJ UUA 1. UUG Leu UCC Ser UCA UcO CUU CUC Leu CGU CAUTHis CU CAC. CAA CAG CGC Pro Arg CUA CCA CGA CG, CUG AUU AGU Ser AGC. ACU AUC File A AUA ACC Thr ACA AAC AAA Lys AGA Arg AUG Met ACG AAG GAU GUU GUC GUA GUG GCU GCC GAC. GAA GAG Gu Asp GGU] GGC Gly val Ala GCA GCG) GGA GGG) G 1. Which codon (from 5-3) on the MRNA strand codes for this amino acid? (write your answer in the first box) 2. Which amino acid this RNA binds? (write your answer in the second box) First letter Third letter
Main... My Drive - Google... 8. Which statement/s about RNA is/are true? (Select all that apply.) * RNA is made through the process of translation RNA is made through the process of transcription and translation RNA is made through the process of transcription Some types of RNA just exist in the nucleus without ever needing to be made 9. Identify the TRUE statement about the process of transcription: * RNA polymerase requires an RNA primer molecule before it can begin transcripti DNA is not needed for the process of transcription. RNA polymerase binds to a promoter region in the DNA to initiate transcription. During the elongation phase, RNA transcripts are built from 3' to 5'. 10. Which is correct? * Translation occurs in the nucleus; transcription occurs in the cytoplasm Transcription occurs in the nucleus; translation occurs in the cytoplasm Both transcription and translation take place in the cytoplasm Both transcription and translation occur in the nucleus 1
CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out) 2. Figure out the tRNA triplet (codons) that would fit the mRNA triplets. (letter by letter) 3. Look up for each tRNA codon and find the corresponding symbol and amino acid abbreviations. The symbols should spell out a meaningful English message.
CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out)
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 20 ORI 40 60 3' ТТCGAGCTCTCСТCGTCGAGATACGCGAT SCGATGATATTAC: ТАСTGGTAATАTоGGGATGCACTAТС AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCANTATAÇCCCTACGTGATAG ΤΑTC 5' promoter RNA polymerase Practice Question 4 B) What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3' ribosome
If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What would the final protein product be? (only use the capitalized letters).
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAA! AAGCTCGAGAGCAGCAGCTСТАTGCGCTAСТАТААТGACСАТТАТАССССТАСGTGATAG 3' СTGGIAATATOGGGATGCACTАТС 5' RNA promoter polymerase Practice Question 4 F) You also study the expression of different mutants for this gene. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above). For mutant B answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter m in…
Figure 16.13 An increase in phosphorylation levels of elF-2 has been observed in patients with neurodegenerative diseases such as Alzheimer’s, Parkinson's, and Huntington's. What impact do you think this might have on protein synthesis?
Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile – Tyr – Lys – Asp mRNA sequence (5’-3’)AUG – AAC – UGU – UUU – GAA – AUG – CUU – CGU – AUU – GAU – GAA – GGU – CUU – CGU – CUU – AAA – AUU – UAU – AAA – GAU - Write the dsDNA that encodes for this peptide
w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdf
Compare the two DNA sequences shown below and consider the single nucleotide mutation made in the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: ATG CGC ТСС САТ стт ААС АAА GAG GTT GG C TAT TT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: АTG CGC ТСС САТ стТ ААС АAG GAG GTT GGC ТАТ ТТT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe missense nonsense frame-shift silent antisense