1.Which protein and nucleic acid molecules are present in the PDB structure with codeIKX3?Histones 2A and 2B and DNA only.DNA only.Histones 3 and 4 and DNA only.Histones 2A, 2B, 3, 4 and DNA.DNA ligase.1.2.3.4.5.Which amino acids would you expect to find buried in the interior of peripheralmembrane protein?1.leucine, methionine2.threonine, glutamatetyrosine cysteine3.4.5.lysine, argininehistidine, glutamic acidA basic leucine zipper1.3is the name of a full transcription factor protein.interacts with RNA polymerase.is a portion of a full transcription factor protein.is used to join any type of protein domains.cause aggregation of transcription factors.4DNA methylation acts to inhibit gene expression by1.altering the DNA structure and interfering with proteins that bind.changing binding of histones to DNA.3.activating the binding of bromodomain containing proteins.4.2.forming acetyl groups.changing the TATA box sequence.5.A-23452.

PDB is the protein data bank that consists of the molecular model. Each model has a unique…

1. Which protein and nucleic acid molecules are present in the PDB structure with code IKX3? 1. Histones 2A and 2B and DNA only. DNA only. Histones 3 and 4 and DNA only. Histones 2A, 2B, 3, 4 and DNÁ. DNA ligase. 2. 3. 4. 5.

1. Which protein and nucleic acid molecules are present in the PDB structure with code IKX3? 1. Histones 2A and 2B and DNA only. DNA only. Histones 3 and 4 and DNA only. Histones 2A, 2B, 3, 4 and DNÁ. DNA ligase. 2. 3. 4. 5.

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 23RQ: Which of the following is not made out of RNA? the carriers that shuffle amino acids to a growing...

See similar textbooks

Related questions

Q: 2. One repair mechanism for double-strand breaks involves the unwinding of the damaged DNA followed…

A: Introduction Deoxyribonucleic acid, also known as DNA, is the molecule that carries the genetic…

Q: 9 The table opposite shows the standard riplet codes for the 20 amino acids involved in protein…

A: Transcription is the process in which the DNA strand which codes for a protein and e converted to…

Q: Which of the following statements about DNA is true? (Select all that applied) Select one: O a. DNA…

A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…

Q: 5.State the contribution of the following scientists to the understanding of DNA structure: a)Erwin…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…

Q: 1. How do you determine the purity of DNA? If a DNA has 1.8 A260/A280 ratio, what does it mean? What…

A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…

Q: 1. How many codons are there in the Original DNA sequence? 2. How many codons are there in the MRNA?…

A: Introduction When a DNA gene is disrupted or damaged in such a way that the genetic message carried…

Q: How can you modify your DNA model to reflect changes among DNA molecules?

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: 1. Which of the following is the correct order for the steps in DNA extraction? I. Precipitation of…

A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we are…

Q: 2. Fill in the labels on this diagram of a DNA molecule: Adenine Thymine .H2N OH NH H2N NH N' NH;…

A: DNA is deoxyribonucleic acid. It is a molecule of herdity. it is made up of nucleotides. A…

Q: 2. What polypeptide will be created from the following strand of DNA? DNA A T. T A C A C MRNA AA

Q: 2. What is the function of each of the replication enzymes listed below? a. DNA polymerase III b.…

A: The DNA replicates itself multiple times during the replication process. It is a biological…

Q: .1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…

A: The Chargaff’s rule state that the quality of the nitrogenous base pairs in the DNA is always equal.…

Q: 5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC-3'

A: DNA sequencing is the biochemical method used for determining the order of nucleotide bases, A, G,…

Q: 3. One repair mechanism for double-strand breaks involves the unwinding of the damaged DNA followed…

A: DNA repair is the correction of incorrect nucleotides or missing nucleotides in a single strand or…

Q: #1 under Identify the Structures is what.... A. original strands of DNA B. backbone of DNA C.…

A: The deoxyribonucleic acid (DNA) is the double-stranded molecule which is the genetic material in…

Q: The code message begins with a triplet call a _33__ , followed by the code, then signals the end…

A: Gene expression is the process by which DNA expresses itself and synthesizes proteins.

Q: The polarity of DNA synthesis is A. 5' 3'. O B. 3' 5'. O C. 5' 2'. OD. 2- 5'. E. None of the choices…

A: Answer - option A - 5'-->3' DNA replication is semiconservative. Each strand in the double…

Q: 3 features of DNA markers

A: DNA markers are basically the fragment of the portion of the DNA whose location as per the genome is…

Q: Identify the Structures is what? A. original strand of DNA B. DNA backbone C. nitrogen bases…

A: J.D Watson and F.H.C.Crick(1935) proposed a double helix model of DNA molecule, this is the widely…

Q: 9.)Which of the following does NOT describe the molecular structure of (DNA) Deoxyribonucleic Acid?…

A: 9- DNA is a double helix ,deoxyribose sugar made up of nitrogenous bases while RNA is ribose sugar.…

Q: AKS 5b: Use the image below to answer the question that follows. Below are the interpretations of…

A: The process in which the DNA makes the exact copy of itself while the process of cell division. This…

Q: 4. The sequence of base triplets on the coding strand DNA molecule is TGACCGTTAGCG. Which of the…

A: The genetic code is sometimes referred to as a "blueprint" since it provides the instructions that a…

Q: Only silenced DNA is wrapped around nucleosomes, active DNA is loose in the nucleus.

A: DNA silencing is the regulation of gene expression in a cell to prevent the expression of a certain…

Q: 8) Capillary electrophoresis involves a) Fragmentation of the DNA strands b) High resolution…

A: Capillary electrophoresis is an experimental methodology that provides an applied voltage to…

Q: 1. This diagram is showing the process of 2. If the original template strand reads: TTACGCAGT, DNA…

A: DNA replication is a process by which DNA makes a copy of itself. It does this by the help of enzyme…

Q: 2. Predict the following sequences of base in the DNA strands complementary to the single RNA…

A: A molecule that consists of a long chain of repeating units called nucleotides. The sequence of the…

Q: 9- Considering the structure of double-stranded DNA, which kind(s) of bonds hold one complementary…

A: Deoxyribose Nucleic acid (DNA) is the basic genetic material of life. It is made up of two strands…

A: Purines is equal to pyrimidines. So A=T C=G

Q: 3. Give the different hydrolytic products of : a. DNA b. RNA

A: DNA and RNA are made up of long chains of nucleotides. Sugar molecule, ribose in RNA, and…

Q: Explain the central dogma - how DNA, RNA, and proteins are related.

A: The gene is the sequence of nucleotides that require certain processes to express it into protein.…

Q: 1. For each of the items below, give a brief description (indicate function for enzymes) and…

A: The process of replication and transcription are catalysed by different Enzymes and proteins. The…

Q: Explain the following relationship: DNA formats RNA, which makes proteins.

A: DNA and RNA are two types of nucleic acids. DNA provides the code for the cellular activities while…

Q: 1

A: INTRODUCTION:- A mutation is any change in the nucleotide sequence of DNA.Some mutations affect…

Q: 4. Draw and label a model that shows how complementary base-pairing is used to create a new strand…

A: DNA replication occurs within the cytoplasm of prokaryotic cells and nucleus of eukaryotic cells.…

Q: 7. What are the 4 nitrogen bases? 1. 2. 3. 4. 8. What is their purpose? Why does their order matter?…

A: DNA is a polymer of nucleotide. One nucleotide is made up of one nitrogenous base, one phosphate and…

Q: 1. Fill in the blanks in the table below regarding the similarities and differences between two…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: How are these outlines related to the big picture of mutations influencing the expresssion of…

A: Hello there. As you have posted a question with multiple subparts, I will be answering the first 3…

Q: 1. Two chains of DNA must run in directions and must be bond to each other. a. Opposite,…

A: Introduction DNA Is The Chemical Name For The Molecule In All Living Things That Conveys Genetic…

Q: 1. A sample DNA was analyzed. 42% of the nucleotides contained Adenine. Calculate the % of…

A: DNA or deoxyribonucleic acid is the molecule present in almost all the living things that code for…

Q: Guanine was oxidized into 8-oxoguanine, which process below will ensure the integrity of the DNA?…

A: DNA repair system specifies a collection of processes, through which a cell identifies and corrects…

Q: 21. DNA replication is A. Semiconservation B. Conservative C. Dispersive D. Heteroconservative 22.…

A: DNA is the genetic material of most of the living organisms. Any substances which are capable of…

Q: 10) Which statement accurately describes DNA? A) Double Helix C) Remains in the nucleus D) All of…

A: DNA is deoxyribose nucleic acid which, and contain genes also.

Q: Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. Approximately what…

A: Answer - Option B - 8%

Q: True or False: 1. The concept of DNA was discovered through a series of careful experiments. 2.…

A: DNA is found in every cell of an organism in which they act as genetic material. DNA is the nucleic…

Q: Cytosine (C) makes up 30% of the nucleotides in a sample of DNA. What percentage of the sample is…

A: DNA has 4 nitrogenous bases which hold DNA strands together by hydrogen bonds. Adenine, Guanine,…

Q: 3. The enzyme responsible for transcribing complementary DNA from mRNA is DNA Polymerase…

A: 3. the process of transcribing complementary DNA from RNA is called as reverse transcription. this…

Q: II. Phoebus Levene (1920s) He is perhaps best known for his incorrect tetranucleotide hypothesis of…

A: Phoebus Levene is an American chemist and best known for his work on nucleic acids. He discovered…

Q: Regarding the triple DNA code, which of the following statements is true?

A: The genetic code refers to the set of rules that all living organisms use to encode information,…

Q: Which of the following statements is true for double-stranded DNA? O All of the given choices are…

A: All cellular lifeforms have DNA as their genetic material. A double stranded DNA (dsDNA) is composed…

Question

1.
Which protein and nucleic acid molecules are present in the PDB structure with code
IKX3?
Histones 2A and 2B and DNA only.
DNA only.
Histones 3 and 4 and DNA only.
Histones 2A, 2B, 3, 4 and DNA.
DNA ligase.
1.
2.
3.
4.
5.
Which amino acids would you expect to find buried in the interior of peripheral
membrane protein?
1.
leucine, methionine
2.
threonine, glutamate
tyrosine cysteine
3.
4.
5.
lysine, arginine
histidine, glutamic acid
A basic leucine zipper
1.
3
is the name of a full transcription factor protein.
interacts with RNA polymerase.
is a portion of a full transcription factor protein.
is used to join any type of protein domains.
cause aggregation of transcription factors.
4
DNA methylation acts to inhibit gene expression by
1.
altering the DNA structure and interfering with proteins that bind.
changing binding of histones to DNA.
3.
activating the binding of bromodomain containing proteins.
4.
2.
forming acetyl groups.
changing the TATA box sequence.
5.
A-2345
2.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin. Normal Sequence Mutated Sequence DNA DNA amino acid DNA DNA amino Codon MRNA Codon MRNA coding template strand coding template strand strand acid code code strand sequence sequence G 1 1 G G C 2 A 2 A 3 G G A A 4 4 C G A G G G G 7 A 7 A G G Shape of RBC Shape of RBC 23 3.
Which of the following is not made out of RNA? the carriers that shuffle amino acids to a growing polypeptide strand the ribosome the messenger molecule that provides the code for protein synthesis the intron
Protein 2: DNA AGAGTTCTGCCCTGTCGATTT MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis?
Given DNA strand: 5' T G T T A G T C G A A T 3' Write its complementary DNA and its mRNA.
Hi, Could you please comfirm the following question. I have selected option c) because tRNA is the the complimentary pairs of mRNA so I figured the oppside end of the tRNA would be the same as the mRNA. When I have tired to double check my answer, no tutor has selected this answer. Thank you in advance, Like mRNA, tRNA has a ribose sugar, U instead of T, and is single stranded. Unlike mRNA, which remains a long single strand of nucleotides, tRNA folds so that some areas pair up. The resulting structure has an anticodon on one end and a site for an amino acid to attach on the other end. There is base complementarity (A pairs with U and G pairs with C) between an mRNA codon and tRNA anticodon.If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the opposite end of the tRNA molecule? a. UUU and UUC b. AGA and AGU c. AAA and AAG d. UCU and UCA
2_53392678751... material, separate from the DNA in the nucleus, and can make copies * .of themselves the lysosomes and peroxisomes. the endoplasmic reticulum. the mitochondria. the ribosomes. نقطة واحدة * :The range of the blood pH is 7.0 to 7.50 7.30 to 7.40 7.40 to 7.53 7.35 to 7.45 نقطة واحدة The . . are the rarest form of white blood cells and are involved in >
A peptide has the sequence NH 2-phe-pro-lys-gly-phe-pro-COOH. Which of the following sequences in the coding strand of the DNA could code for this peptide? O S'ACT-TAC-CAT-AAA-CAT-TAC-UGA 5' TTT-CCC-AAA-GGG-TTT-CCC 3' UUU-CCC-AAA-GGG-UUU-CCC 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG
II. Give the translation of the segment of a polypeptide chain below. Specify your template strand. -GG CT |||||| -c C GATC G ACGAAGGAACCCCT- GGGGA- |||||
1. It is a large complex ribonucleoprotein particle that chemically modifies the pre mRNA strand by the removal of introns 2. This is a linkage between paired bases in the secondary DNA structure 3. It refers to the linkage between 2 nucleotides in the DNA molecule 4. Give the range of the number of nucleotides present in a single protein molecule 5. Identify the number of bases included in the nucleosome 6. It is an enzyme that cuts the bacterial plasmid at its cleavage site
II. Give the translation of the segment of a polypeptide chain below. Specify your template strand. GGG A- GG C TA GCTG ||||| ||||| || || | ||| || | -CC GAT C GACGA AGG AACCCCT-
Histones are a family of positively charged proteins binds tightly with negatively charged, DNA, Histones most likely contains amino acids with R groups of what type? O a. AcidicR group O b. Basic R group O c. Hydrophobic R group O d. Hydrocarbon R group O e. Non-polar R group
A peptide has the sequence sequences in the coding strand of the DNA could code for this peptide? NH₂-phe-pro-lys-gly-phe-pro-COOH. Which of the following 5' TTT-CCC-AAA-GGG-TTT-CCC O 5' ACT-TAC-CAT-AAA-CAT-TAC-UGA 3' UUU-CCC-AAA-GGG-UUU-CCC 5' AUG-AAA-GGG-TTT-CCC-AAA-GGG O 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG First letter U A G U บบบ UUCJ UUA UUGJ CUU CUC CUA CUG GUU GUC Phe GUA GUG Leu AUU AUC lle AUA AUG Met Leu Val Second letter UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala G UAU UAC Tyr UGC Cys UAA Stop UGA Stop UAG Stop UGG Trp G CAU CAC J CAA 1 CAGJ AAU 1 AAC AAA1 AAGJ GAU GACJ GAA1 GAGJ His Gin AGU AGC AGA Lys AGG Asn CGU CGC CGA CGG Asp Glu GGU GGC GGA GGG Arg Ser Arg Gly DUAG DCAU DUA ULAG Third letter