Q: A bacterial cell in which the F plasmid is integrated into the chromosome is known as an F-…
A: Hfr cell is defined as high-frequency recombination cell is a bacterium which is a conjugative…
Q: 2. Scientists now routinely use CRISPR/Cas9 to makedefined deletions of a gene that can remove…
A: Nowadays, scientists are using CRISPR/Cas9 for making necessary deletions in the genome of the…
Q: The enzymes required to breathe fire (BFi2) is expressed in throat tissues of dragons from the Known…
A: DNase 1 enzyme is responsible for digesting the DNA into fragments.
Q: 10. V(D)J recombination contributes to the diversity of immunoglobulins, and occurs by: A. Random…
A: Recombination or crossing across occurs, in this procedure, genetic material is exchanged between…
Q: 6.) How does RNAi maintain the heterochromatin at the centromeres of chromosomes?
A: Heterochromatin is a form of DNA (deoxyribonucleic acid) that is dense or closely packed. It varies…
Q: Nonallelic homologous recombination between repeats in the same orientation would not produce: O…
A: A mutation is a permanent change in the DNA of a cell such that the sequence deviates from what is…
Q: 41) In a bacterial cross in which the donor (Hfr) is a+b+ and the recipient strain (F-) is a-b-, it…
A: D) Will all be a+b+ Explain;- The formation can be characterized as the course of transmission of…
Q: 7- What type of inversion has break points that flank the centromere? a) paracentric b) O…
A: Inversion is a phenomenon where chromosome rearrangement takes place, breakage and rearrangement…
Q: 5. The downstream process for a recombinant protein begins with 100 liters of clarified lysate. At…
A: Protein purification is series of processes to isolate one or few proteins from a complex mixture of…
Q: 3) Below are two homologous chromosomes. The top chromosome has suffered a double-strand break.…
A: When a DNA strand suffers a damage as shown above, it repairs by homologous recombination. The step…
Q: 5.If the following two primers 3'AAGS' S'CCG3' were used to facilitate the polymerase chain reaction…
A: Deoxyribonucleic acid (DNA) refers to the polymer that is made of nucleotides. A nucleotide…
Q: 17. A chromosome is found to be shorter than its homologous match. Which type of mutation would this…
A: Mutation can be described as a condition in genetics during which alternation occurs in an…
Q: Draw the structure of the double Holliday junctionthat would result from strand invasion by both…
A: Holiday junction are intermediates of homologous recombination and this junction formation occur…
Q: a)What is the complementary strand of TTGACAGTAAAA? b)List the possible genotypes for an individual…
A: a) Complementary strand has nucleotides AACTGTCATTTT Thymine (T) base pair with Adenine (A) with two…
Q: 4. The bars in the following sequence indicate the breakpoints of a deletion.…
A: The given sequence has bars indicating the breakpoint of a deletion means we are going to delete the…
Q: What is the role of Cohesin complex in the Polytene Chromosome?
A: Polyetene chromosome is the largest chromosome present in the salivary glands. Polytene chromosome…
Q: 12) Draw a yeast knockout cassette. Label all required sequence features. a) Draw the target…
A: Hi! As you have posted multiple questions and asked to provide with two knockout diagrams, we are…
Q: 2. Give two different reasons for the much higher ratioof total DNA to protein-encoding DNA in the…
A: DNA is a polymer of nucleotides arranged in unique sequence in different organisms. It forms the…
Q: Describe step 6 of recombination: Resolution of the Holliday Junction
A: Introduction: during meiosis, exchange of genetic material occurs. this happens when genes of same…
Q: 8. Using recombinant DNA techniques (which willbe described in Chapter 9), it is possible to take…
A: Recombinant DNA technology is the process in which the recombination of genetic material takes place…
Q: 21. A chromosome initially has the following segments: AB•CDEFG Draw the chromosome, identifying its…
A: The chromosome segment A B . C D E F G Tandem duplication of DEF - A B . C D E F D E F G Displaced…
Q: Explain the V(D)J recombination of multiple gene elements
A: RECOMBINATION It is the process in which pieces of DNA are broken physically, exchanged, and then…
Q: 10. Which of the following sequences would you expect to be a part of a beta turn? O PAAG O PAGA O…
A: Beta- turns are the simplest secondary structure, connecting two helices or sheets. They are…
Q: 2. Null mutations are valuable genetic resources becausethey allow a researcher to determine what…
A: A null mutation is a mutation in which a copy of a gene becomes non-functional. This type of…
Q: 2. A series of 2-point crosses were carried out among 7 loci (a, b, c, d, e, ƒ, and g), producing…
A: Linkage group, in genetics, all of the genes on a single chromosome. They are inherited as a group;…
Q: 6. A diploid strain of yeast was made by mating a haploidstrain with a genotype w−, x−, y−, and z−…
A: Mutation is defined as sudden inheritable change that occurs in the DNA sequence. It may be…
Q: 6. A research group has selected three independent Trp−haploid strains of Neurospora, each of which…
A: Hello there! As you have posted multiple questions, we are answering only the first two questions…
Q: 2ith the diagram provided please write the polypeptide. sequence obtained from the translation of…
A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…
Q: Item humbers 15 to 19. Refer to the figure below. (answers are in letters only) B A. B b a. B B A. a…
A: The exchange of genetic material between non-sister chromatids of homologous chromosomes is known as…
Q: A diploid human cell contains approximately 6.4 billion base pairs of DNA. Q.How many histone…
A: The histones are the basic proteins family that are attached to DNA inside the cell. These basic…
Q: 9. Common red clover, Trifolium pratense, is a diploidwith 14 chromosomes per somatic cell. What…
A: The genus family species Trifolium sp belong to Fabaceae. Red clover (Trifolium pratense L.) act as…
Q: 13) What is the purpose of the negative selectable marker in a mouse knock out cassette? a) Why…
A: The negative selection marker used for the creation of knock-out mouse is thymidine kinase gene…
Q: The following are techniques that create bands along the length of a chromosome, EXCEPT: A.…
A: Quinacrine banding, Giemsa banding, and Reverse banding are the techniques that create bands along…
Q: 1. Illustrate. Consider the given pair of homologous DNA molecules. W X Y W' X' Y' w' x' W X y Z…
A: A Holliday junction is a nucleic acid structure with four double-stranded arms that are linked…
Q: 50. Which of the following represents the inactive X-chromatin in female cells? O euchromatin O…
A: Given: The following represents the inactive X-chromatin in female cells.
Q: Bloom syndrome in regards to faulty DNA give detailed reponses provide exmaples
A: Genetic diseases are diseases that are caused by abnormalities in genes. Autosomal disorders are…
Q: 1. In adults, these DNA regions would contain the genes for hemoglobin. a. euchromatin b.…
A: Chromatin can be defined as a complex threadlike structure made up of DNA and proteins found in…
Q: The sequences of the recombination sites recognized by site-specific recombinases area) Partially…
A: Recombination is a process by which pieces of deoxyribonucleic acid (DNA) are broken and recombined…
Q: 1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting…
A: TAS2R38 is a taste receptor gene present in the 7th chromosome of the genome. The length of a gene…
Q: 7. (a) Describe the mechanism by which human cells maintain a chromosome structure that consists of…
A: As per the guidelines, we are entitled to do the first part of the solution. So, I am providing a…
Q: 7:12 What is not true for Sequence tagged site (STS) markers: O cannot be mapped by fluorescence in…
A: Any sequence of DNA which shows polymorphism and can be recognized utilizing a molecular method is…
Q: 4. and produce gametes that are dominant C phenotype. Draw a diagram clearly showing how intragenic…
A:
Q: Which steps in the double-strand break model for recombinationwould be inhibited if the following…
A: Introduction: Double-strand break repair model for recombination is a mechanism of gene…
Q: 6.6 Describe crossing over. Explain how it is related to recombination
A: Ques : Describe crossing over. Explain how it is related to recombination
Q: 21. If the original sequence of chromosome is L M NOPQRS and two chromosome mutation occurs,…
A:
Q: 39 The structures labelled A and B in the image below represent: CTAAATCGGT Allele for red flowers B…
A: Answer: Incomplete Dominance : When the gene expression of one allele expresses completely and the…
Q: Chromosomal rearrangements can be caused crossing over between repetitive (duplicated) DNA segments…
A: Genetic variation ranges from a single nucleotide which is called single nucleotide polymorphism to…
Q: In a DNA study, from a patient with mental retardation, the FMR1 gene is located, which causes many…
A: Mutations are sudden heritable changes in the nucleotide sequence that alters the amino acid and…
Q: 1. How does site specific recombination differ from homologous recombination? a. It requires a…
A: How does site specific recombination differ from homologous recombination Answer : a. It requires a…
Q: My drawing refers to this question.
A: A normal chromosome and its homolog carrying a paracentric inversion given below:
Step by step
Solved in 2 steps with 2 images
- 2 3 inte tion of Lormhda. ne att si ucated betwee de ne att sites and go ns one te n vacter aged ot utilize doot ractose ato la t don s gal* uc Integration to form prophage om SOward cor coct some cro on! ni imple ex 2 3 bio* gal* 14. The figure provided portrays the integration of Lambda phage into a host chromosome at the att site, located between the gal+ and bio+ genes. This prophage may disintegrate from the host carrying with it host genes, such as gal+ and/or bio+ and go on to transduce another host bacterium. How would one determine if a gal- host bacterium's phenotype was changed from gal- to gal+? To clarify, the minus version cannot utilize galactose as a carbon source for growth because it does not produce galactase, the enzyme that hydrolyzes galactose into monomeric sugars. There is a straight forward answer/solution to this – do not concoct some crazy solution! Think simple experiment.help. 1. To produce a specialized-transducing mycobacteriophage construct, a cosmid bearing the allelic exchange substrate is electroporated in Mycobacterium smegmatis, followed by an incubation at 30°C. True/ False 2. A recombineering system involves the over-expression of recombinase proteins, which allows the use of a short DNA fragment as allelic exchange substrate, but can also be combined with the use of a mycobacteriophage construct. True/ False27. Identify a FALSE statement from the following, if any Group of answer choices both fimbriae and pili are made of the same protein sex pili are involved in conjugation process basal body (of flagella) has a central rod and 1 or 2 pair of rings metachromatic granules ( aka polyphosphate granules ) are used in nucleic acid as well in phospholipid synthesis self transmissible plasmids codes for sex pili none of the above is a false statement 32. Proteus sps is unique since it ferments ……………………………. Group of answer choices lactose glucose sucrose both glucose and lactose neither glucose or lactose 37. Protein synthesis ( aka translation) is an example of, Group of answer choices anabolic pathway. respiratory pathway fermentation pathway catabolic pathway 38. ETC members that functions as proton pumps are ……………………components of membrane Group of answer choices Lipid Peripheral Nonprotein Integral Enzyme 39. Vitamin K is made from…
- --ina Category 1: Cell Structure and Function rartlu into a Prokaryotic Pizza and a Cut out the s Eukaryotic I Reporting Category 2: Mechanisms of Genetics Instructions: Answer the questions shown below on the following answer sheet. SATGAGGGCGAGCGGCGCCCACGTTTTAGGGTGA 3'TACTCCCGCTCGCCGCGGGTGCAAAATCCCACTS 1. What is the name of |||| molecule? Celle whethe is a large cell's gen thin laye The nucl Eukary Prokar tain nu meanin meani otic ce Prol simp 2. What cellular process is being shown by the arrow? 3. Where in the cell does this process take place? S'AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA³ MRNA 4. RNA should be in a 5' to 3'direction. Based on this 5. What cellular process is being shown by the arrow (MRNA to amino Information which DNA strand will be your template strand to make the acida MRNA? 6. Where in the cell does this process take place? Amino acids exce Use the codon chart to determine the correct amino acids. (you may abbreviate) ger 7. How many MRNA bases ot make up a codon?…Row C D. B B. one: A C O phage with radiolabelled protein coat phage with radiolabelled DNA 100 10. phage infects The experiment shown above was designed by bacterium phage infects bacterium EXPERIMENT 1 phage shell is removed EXPERIMENT 2 요 Hershey & Hershey & Chase Meselson & Stahl Meselson & Stahl 8 phage shell is removed 28 no radioactivity in cells ii 48 radioactivity in cells LL and proved that ii DNA replication is semiconservative DNA is the hereditary material DNA replication is semiconservative DNA is the hereditary material (select the row that correctly completes the statement)b. Cleavage with chymotrypsin produces the following fragments: Band A: CN , NLQY, GIVEQCCHKRSEY Band B: F, Y, DPTKM, IACCVRGF, RTTGHLCGKDLVNALY Cleavage with Staphilococcus aureus V8 protease produces the following fragments: Band A: GIVE, YNLQNYCN, QCCHKRCSE Band B: PTKM, RTTGHLCGKD, LVNALYIACGVRGFFYD What is the amino acid sequence of the protein? Type your response
- Arial BIUA 11 + .. | I 1 I 3 I 4 i.) Fill in the table for each of the E. coli: (0) = No Activity (+) = Basal Activity and (+++) = High Activity E. coli chromosome F' Plasmid B-gal activity? Permease activity? When When When When Glucose is Lactose is Glucose is Lactose is present present present present a.) I+ P+ O+ Z+ Y+ Inone +++ +++ b.) I^[S] P+ O+ Z+ Y+ none c.) I+ P+ O^[c] Z+ Y+ none d.) I+ P+ O- Z- Y+ none e.) I+ P+ O+ Z+ Y+ I^[S] P+ O+ Z+ Y+ f.) I^[S] P+ O+ Z- Y+ I+ P+ O^[c] Z+ Y- g.) I^[TB] P+ O+ Z+ Y 1+ P+ O^[c] Z- Y+ h.) I+ P+ O^[c] Z+ Y- I+ P+ O+ Z** Y+ i.) I^[TB] P+ O^[c] Z+ Y- 1+ P+ O+ Z- Y+ Z** is a polar mutation ii. ) If the lac operon in 'a' carried a mutation in the CAP binding site that rendered it nonfunctional, how would that affect the level of ß-galactosidase protein activity with and without lactose present, why? MacBook Air 000Below is a diagram of the general structure of the bacteriophagel chromosome. Speculate on the mechanism by which it forms aclosed ring upon infection of the host cell. 5'GGGCGGCGACCT:double@stranded region-3' 3'- double@stranded region:CCCGCCGCTGGA5'3. What would a growth curve of the chlamydia bacteria look like starting from Sammys initial infection? Draw a simple graph and indicate where (a) her antibiotic treatment started, and (b) two weeks post-treatment. 5.The following is a partial ribosomal DNA sequence of a chlamydia gene that encodes for one of its ribosomal proteins. Blood samples were taken from Sammy before and after she started the antibiotic treatment, and there is a change between the two populations. Please identify the point mutation and the amino acid that changed, and provide one reason why a ribosomal mutation could affect antibiotic resistance to doxycycline. Pre-antibiotic treatment: ATG-GCT-GCT-AGC-GCT-TCA-AAG-GGC-AAG-AGT-AAA Post-antibiotic treatment: ATG-GCT-GCT-AGC-GCT-TCA-AAC-GGC-AAG-AGT-AAA 6.
- 1. Precise words:Find the nonspecific terms in the following sentences. Replace the nonspecific choices with more preciseterms or phrases (It is not necessary to change the sentence structure).(i) All OVE mutants showed enhanced iP concentrations.(ii) Plants were kept in the cold overnight.(iii) To provide proof of concept for our hypothesis, we studied a virus in its host cell.(iv) The present paper reports on continuing experiments that were performed to clarify thissurprising effect.(v) The first transition state is a little lower in energy than the second transition state. 2. Simple words:Improve the word choice in the following examples by replacing the underlined terms or phrases withsimpler word choices (do not change the sentence structure).(i) These data substantiate our hypothesis.(ii) The difference in our results compared to those of Reuter et al. (1995) can be accounted forby the fact that different conditions were used.(iii) For the purpose of discussing cell migration we…As described in Figure, host DNA is hydrolyzed into smallpieces, which are occasionally assembled with phage proteins, creatinga phage with bacterial chromosomal DNA. If the breakage ofthe chromosomal DNA is not random (i.e., it is more likely tobreak at certain spots as opposed to other spots), how might nonrandombreakage affect cotransduction frequency?1. This template strand has a mutation in its complement. Which letter is incorrect?TGACGTACTCCA
