1 kb B1 kb E 6 kb Gene X E1 kb B 5 kb. Gene Z Ечко! B 1 kb ← The figure above shows a linear chroínosome containing Gene X and Gene Z and the location of sites for the restriction enzymes EcoRI (E) and BamHI (B). Refer to this map as you answer the question below. If you digest this DNA with EcoRI, then perform agarose gel electrophoresis, how many bands, and what sizes, would you expect to see? a) Two bands on the gel corresponding to the sizes 2 kb and 6 kb b) Three bands on the gel corresponding to the sizes 1 kb, 6 kb and 8 kb. c) Three bands on the gel corresponding to the sizes 1 kb, 5 kb and 6 kb d) Four bands on the gel corresponding to the sizes 1 kb, 2 kb, 5 kb and 6 kb e) Four bands on the gel corresponding to the sizes 2 kb, 3 kb, 4 kb and 8 kb

1 kb B1 kb E 6 kb Gene X E1 kb B 5 kb. Gene Z Ечко! B 1 kb ← The figure above shows a linear chroínosome containing Gene X and Gene Z and the location of sites for the restriction enzymes EcoRI (E) and BamHI (B). Refer to this map as you answer the question below. If you digest this DNA with EcoRI, then perform agarose gel electrophoresis, how many bands, and what sizes, would you expect to see? a) Two bands on the gel corresponding to the sizes 2 kb and 6 kb b) Three bands on the gel corresponding to the sizes 1 kb, 6 kb and 8 kb. c) Three bands on the gel corresponding to the sizes 1 kb, 5 kb and 6 kb d) Four bands on the gel corresponding to the sizes 1 kb, 2 kb, 5 kb and 6 kb e) Four bands on the gel corresponding to the sizes 2 kb, 3 kb, 4 kb and 8 kb

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

he gel presented here shows the pattern of bands of fragments produced with several restriction enzymes. (a) From your analysis of the pattern of bands on the gel, draw the correct restriction map and explain your reasoning. (b) The highlighted bands (magenta) in the gel hybridized with a probe for the gene pep during a Southern blot. Where in the gel is the pep gene located?
Below is a plasmid with restriction sites for Baml and EcoRI, Several restriction digests were done using these two enzymes either alone or in combination. Hint: Begin by determining the number and size of the fragments produced with each enzyme. "kb" stands for kilobases, or thousands of base pairs. Plasmid Gel lanes I | III IV V 6 Kb Bam HI Bam HI. 20 Kb PGEN101 (20 Kb) 2 Kb 11 Kb Bam HI 8 Kb 8 Kb 4 Kb 6 Kb Eco RI 3 Kb 21. Which lane shows a digest with BamHl only? a. I b.I c. II d. IV e. V 22. Which lane shows a digest with EcoRLonly? a. I 23. Which lane shows the fragments produced when the plasmid was incubated with both EcoRI and BamH1? a. I b.I c. II d. IV e. V b. I c. II d. IV e. V Base pairs
Given the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA Identify two blunt-end cutters Identify two sticky-end cutters. For each, Provide the sequence of the Restriction enzyme, Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA Indicate the…
You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA encoding this peptide is included in the sequence shown below. 5'-CGTGACGGCTCGTGGAAGCTAGTCATC-3' 3'-GCACTGCCGAGCACCTTCGATCAGTAG-5' This sequence does not contain any BamHI restriction enzyme sites. The target sequence for the BamHI restriction nuclease is GGATCC. Your goal is to create a BamHI site on this plasmid by manipulating the DNA sequence, without changing the coding sequence of the protein. How would you do this, ie what would the new sequence be?
Use the plasmid map for pBashi below to answer the following questions Xhol Hind!!! 15 kb 11 kb 10 kb 8 kb 7 kb 5 kb a. How large is pBashi? b. On the gel below, draw the bands corresponding to the expected pBashi cleavage products after restriction digest with the indicated restriction enzymes (Lane 2 - Xhol only, Lane 3 - HindIII only, Lane 4 - Xhol+ HindIII) 4 kb 3 kb 3 kb 2 kb 1 kb 4 kb Hindill 1 kb 7 kb Xhol Xhol Xhol Xhol Hind!!! Ladder Xhol Hindill Hind!!! Pstl Pstl c. Lane 5 in the gel above displays the pBashi cleavage products after restriction digest with the restriction enzymes Xhol+ Pstl. Lane 6 in the gel above displays the pBashi cleavage products after restriction digest with the restriction enzymes Xhol+ HindIII + Pstl. Indicate your final answers to the questions below clearly on the pBashi plasmid above; you will NOT receive any credit if you only list sizes of fragments below. If you need to, draft your answer somewhere else before writing your final answer above.…
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Draw the gel electrophoresis results for the following 16 kb plasmid when the plasmid is cut withrestriction enzyme A, with restriction enzyme B and with both A and B restriction enzymes. The Aenzyme cuts at positions 0 and 9.2 kb and the sites are shown as white. (0 is at the top of the circle.) TheB enzyme cuts at positions 3.8, 7 and 13.2 kb and the sites are shown as gray. Show the electricalpolarity of the gel, the bands, and their sizes in your drawing. Make sizes consistent between gel lanes.Explain why the concept of charge density is important for gel electrophoresis.
Given the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.
Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting amount ofa restriction enzyme for a very short period of time.a. Would the resultant fragments be longer or shorteror the same size as those produced by a completedigestion?b. If you prepared genomic DNA from a tissue sample containing millions of cells, would the fragments produced by partial digestion of DNA fromall of these cells be the same or different?
You are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI (E), HindlII (H), and Xbal (X). You digest the plasmid DNA with each of the following combinations of enzymes and observe the results on an agarose gel. You are provided a partial plasmid map as shown below to the right. E H E+H E+X H+X Kb +4.3 +2.8 +2.5 - +2.0 -- -1.8 -1.5 12 +1.0 +0.8 +0.5 - a. What is the size of this plasmid in base pairs? b. What is the distance in base pairs between E1 and H? c. What is the distance in base pairs between E1 and X? d. What is the distance in base pairs between E2 and H? e. What is the distance in base pairs between E2 and X?
Consider the λ bacteriophage DNA molecule as shown in Figure 21.14. Total digestion with the two restriction endonucleases used does not allow unambiguous placement of restriction sites, as shown in the map. Describe restriction patterns—either from partial digestion or from digestion with both BamHI and EcoRI—that would help to establish the specific map of restriction sites shown in Figure 21.14(b).
Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI