Bio 131 Wk 10_REC_ Translation_Activity_STUDENT_Fa2023

Day 3: Trace the Code Learning Task 5. Identify the amino aclds coded for by the MRNA codon using Genetic Code Table. Then anwer the given questions that follow. 8.

AKS 5c1: Which of the following models BEST represents protein synthesis? * O MRNA (UAC AAA) - DNA (ATG TTT) Amino Acid Sequence (Lysine-Alanine) - Amino Acid Sequence (Methionine- DNA (TAC AAA) RNA (AUG UUU) Phenylalanine) RNA (AUG UUU) DNA (TAC Amino Acid Sequence (Methionine-Phenylalanine) AAA) DNA (AUG UUU) RNA (TAC AAA) Phenylalanine) - Amino Acid Sequence (Methionine- AKS 5c1: Using codon wheel below, which of the models correctly represents the usage of the base pairing rule, the correct sequence of events, and creation of proteins at the ribosomes? *

AGUC 24. Use the table below to answer the following question. The template strand of a gene contains this sequence: 3'-TAC TAG GCT AGT TGA-5'. A mutation occurs due to exposure to a chemical mutagen that changes the gene sequence to 3'-TAC TAG ACT AGT TGA-5'. How does this mutation affect the resulting amino acid sequence? (LS3-2) * Second mRNA base A UCU UGU Cys UGC UUU UAU Tyr UAC Phe UUC U UCC Ser UCA Phe Gly (G) Leu Glu (F) (L) UUA UAA Stop UGA Stop A Ser Asp (E) (D) Leu (S) UCG UUG UAG Stop UGG Trp Tyr (Y) Ala CUU CCU CAU CGU U (A) His C G U A CỤC Leu CUA CC Pro CCA CAC CGC Arg CGA Cys (C) G A Val CAA (V) Gln G Trp (W) CUG CCG CAG CGG G Arg (R) G А С A Leu AUU ACU AAU AGU (L) Asn Ser Ser (S) AUC Ile ACC Thr ACA AAC AGC C/ Lys (K) UGA AUA Pro AAA Lys AAG AGA Arg AGG Asn (N) (P) AUG Met or start ACG His Thr (T) Gin (H) (Q) GUU GCU GAU GGU lle Asp Arg (R) (1) GUC Val GUA GCC GAC GGC Ala GCA Gly GGA GAA Glu GAG GUG GCG GGG The mutation changes a single amino acid to another amino…

Day 3: Translation The DNA directs the production of proteins and determines the formation of MRNA. The order of bases of MRNA determines the protein synthesized. Learning Task 4 Make a model of the translation prccess and simulate the steps in translation

Task 3: Place the following events of protein synthesis in order. 1 RNA polymerase attaches to DNA MRNA exits the nucleus 3 | Stop codon is reached 4 Cap and tail added TRNA interpret the mRNA and attach amino acid 6 mRNA strand produced from DNA 7 Protein released from ribosome 8 MRNA attaches to the ribosomal subunits :::: :::: :::: :::: :::: :::: 2.

Please answer fast Give ans for each statement   1.A protein linked to a disease state is being studied by scientists. They discover that the disease protein has the same amino acid sequence as the protein in healthy people. State right or wrong: Does the following explanation provide a plausible biological explanation for the disease state?   a.The RNA polymerase does not correctly read the codon code on the mRNA.   b.The protein is not being regulated properly.   c.The disease protein is incorrectly folded. d. The disease protein lacks a post-translational modification. e.The protein amounts differ because they are expressed differently.

A. =. A Styles Sensitivity Font Paragraph Dictate 7. What are three differences between RNA and DNA? 7. Where is DNA found in the cell? Where is RNA found in the cell? 8. Name the three types of RNA. What is the function of each? Do they function in transcription, translation, or both? 10. What are the steps of transcription? 11. What are the steps of translation? 12. If this is the base sequence of DNA, what is the resulting AA sequence for the following mutations, where mutations and insertions are bolded and deletions are indicated with DNA TAC CGC T C C GCC G T C GA C A AT АСС Аст Mutations: DNA TAC CG C TC C GC C GT C GAC ACT AC C A CT DNA TAC CGG T C C GC GT C GAC A aT ACC AC T DNA TAC CG- T C C GC GTC GACAAT ACCAC T DNA TAC CG CA T CC GCC G T C GACA AT AC ACT What are the consequences of each of these mutations for protein structure? Page 2 of 2 458 words Focus 100%

Activity 2: Mini Taska Given the DNA of the three organisms, determine the mRNA, tRNA, and the amino acids that correspond to the DNA. Amino Acids DNA: mRNA (transcription) tRNA codon (translation) Organism 1: ATA TGG ATG AGG Organism 2: CGC ATA ACA ATC AAA TTA CTA AAC ТАС Organism 3: ATC TGA AAA GTG TTC ACA TCC GTA

Second Letter EQ#10 G. UU UCU UAU Tyr UGU Cys Phe UUC UCC Ser UCA UGC UGA Stop UGG Trp UAC U UAA UUA Leu UUG Stop UCG UAG CGU CCU CCC CAU His CAC CAA CUU CUC Leu CỦA Pro ССА CCG CGC Arg CGA Gla CAG CGGJ Third CUG) First Letter Letter AAU Asn AAC AGU Ser AGC ACU ACC ACA ACG AUU AUC le AGA Arg AGG A AUA AUG Met AAA Lys AAG GGU GGC GUU GCU GAU GCC Ala GCA GAC Asp GAA Glu GAG GUC Val GUA Gly GGA G 15. Given the following (the start of a very long MRNA sequence), GUG GCG) GGG 5' CCGUAAGAUGGCGAACACAUUGUCAUCCAAUGC.... .... 3' what amino acid sequence would be produced in a cell? 16. If the red "U" in the RNA was changed to an A (due to a DNA mutation, for example), what would be the likely effect on the protein, and how might that alter the protein's function? UCAG UCAG UCAG UCAG 复5 C.

5.5. Protein modifications occurring in the Golgi apparatus include : BIOCHEMISTRY_advanced a) removal of sialic acid. b) BiP-mediated protein folding. c) removal of the signal peptide. d) ubiquitination. e) modification of high-mannose and complex N-linked oligosaccharides.

20:201 Foundations Cell Molec 48. The first 17 amino acyl residues in human preproinsulin are H₂N-MALWMRLLPLLALLALW-COOH and the encoding nucleotide triplets ("codons") in DNA are 5'-ATG GCC CTG TGG ATG CGC CTC CTG CCC CTG CTG GCG CTG CTG GCC CTC TGG-3'. Are these molecules written according to their colinearity? A) No. Colinearity is written C-N and 3'-5' for proteins and nucleic acids, respectively. Yes. Colinearity is written N→C and 5'-3' for proteins and nucleic acids, respectively. No. Colinearity is written C-N and 5'-3' for proteins and nucleic acids, respectively. D) There is no such a thing as colinearity. red by ribozymas

estion 12 Which of the following is the complementary MRNA sequence to a DNA gene with the sequence 3' A T CC G IIGAATC 5'? 5' CGAATGGTCCGA 3' O 5'TAGGCAACTTAG3' O 5'C GAAUGGUCCGA 3' O 5'U AGGCAACUUAG3' Moving to another question will save this response.

9 Biology: SC4) x 4 dgv-frqz-vjb x M Inbox (1,514) xB Unit 7: Geneti x O Flipgrid | dc6 x O Worked exam x 4 My Drive - Gc x B copy retake - x G how do you s x + A docs.google.com/document/d/10EqJmVt6VK9YT1NRySx9c2AawGp069S6R6g|28ljkk4/edit I Apps O UCSMP OmnID Portal • SS 9 Home | Schoology M Gmail 4 Google Drive ClassZone - jAvan... flextime.edinasch... N Netflix w Wish - Shopping. >> copy retake ☆ A Share File Edit View Insert Format Tools Add-ons Help Last edit was 2 minutes ago 100% - G E = = E = 1E E - E - E E Image options Replace image- O Editing 31 1 2 | II 3 | 4 5 | 6 7 General Biology Unit 7: Genet. Your "One Pager" must conta. Part 1: Complex Inheritance . + For the two problems, make s.. 2 + Part 2: Pedigree Analysis 2. So, the genotypes of the pare.. II Talking about phenotypes: 2 3 5 6 E I : Shaded individuals have a rare genetic disorder. THIS IS NOT 1. Is the disorder dominant or recessive? How do you know? (Which individuals on the pedigree did you use to make this…

September 18, 2018 13) B-barrel proteins often create pores in cellular membranes. What kind of amino acids are likely to be found on the outer face of the B-barrel? a) Asp, Leu, Gly b) Asp, Lys, Arg c) Léu, Phe, Ala d Gly, Pro, Cys - all renpolar acid rescidues:

Date: Class: Name: Transcription Questions Answer the following questions. 1. What bases are found in RNA? 2. What bases are found in DNA? 3. Which strand is the messenger RNA complementary to? 4. Which strand is the messenger RNA nearly identical to? 5. What proteins help to direct the RNA Polymerase to the right location? 6. The end of a new nucleotide is always added to the end of an existing strand. 7. Distinguish between the following two terms: chromosome and gene. 8. Scientists have long referred to the DNA between genes as "junk DNA". But as scientists study the genome, they discover new and unique reasons why this DNA is not really "junk". Using internet resources, research 2 functions for sections of DNA in between genes. Describe your findings below. C) 2015 Bethany Lau.

Q3. (a) What does the diagram on the next page show? (b) Name a cellular macromolecule in which this modification occurs.

topic: translation how is the growing polypeptide released from the ribosomal assembly?

C. Temination Step 2- Draw (DO NOT COPY-PASTE Images from the Internet) a picture of what is happening in each step in the box labeled "illustration." Label the following structures in each drawing where appropriate: DNA, MRNA, nucleus,cytoplasm, ribosome, rRNA, RNA, amino acid, polypeptide chain Step 3 - Describe (IN YOUR OWN WORDS) what is happening in each step in the box labeled "description." Be sure to include which process (transcription or translation) is being shown and where the process takes place (nucleus or ribosome). Transcription - Initiation Illustration Description A initiation is the beginning of transcription promoter RNA polymerase Transcription - Elongation 1 / 4 Q + Page 近

Learning activity 5 1) A segment of DNA has the following sequence of bases ...5'-ATGCAATGATATTGAAGCTTA -3'... a.) what sequence of bases would appear in MRNA transcribed from this segment b.) assume that the first base in this MRNA is the beginning of a codon. What order of amino acids would be translated into a polypeptide synthesized along this segment? c.) give anticodons for each tRNA associated with the translation in part (b)

TOPIC: E. coli T4 (T4 Bacteriophage) Include a maximum of 3 sentences, a brief description of their growth. What are the structures responsible for growth and reproduction? What are their physical and nutritional (or chemical) requirements?

Date: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.