Data and Analysis Part 5

DNA Extraction by Alkaline Lysis Procedure: 1. Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for 20s to pellet. Remove the supernatant completely with a Pasteur pipet or a plastic pipettor tip. The spins can be performed at FC or at room temperature. Longer spins make it difficult to resuspend cells. 2 Resuspend pellet in 100pul GTE solution and let sit 5 min at room temperature. Be sure cells are completely resuspended. 3. Add 200ul NaOH/SDS solution, mix by tapping tube with finger, and place on ice for 5 min. 4. Add 150ul potassium acetate solution and vortex at maximum speed for 2s to mix. Place on ice for 5-15 min. Be sure mixing is complete. 5. Spin 3 min at 12,000 rpm to pellet cell debris and chromosomal DNA 6. Transfer 0.4 ml supernatant to a fresh tube, mix it with 0.8 ml of 95% ethanol or 0.4 ml isopropanol, and let sit 2 min at room temperature precipitate nucleic acids. 7. Spin at 12,000rpm for 3 min at room temperature to pellet plasmid DNA and…

Part 1. Gene Cloning   1) How is a gene inserted into a plasmid cloning vector? Be specific, but be brief. No more than 2 (non-run-on) sentences please, and do not exceed this space.             2) A geneticist has transformed a vector with an ampicillin resistance gene into E. coli cells and plated those cells on media containing ampicillin.  She comes back 24 hours later and sees only blue colonies on the media. a) How does she know that the cells growing on the media were successfully transformed with the vector?           b) What does it mean that the colonies are blue?

DNA Extraction by Alkaline Lysis Procedure: 1. Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for 20s to pellet. Remove the supernatant completely with a Pasteur pipet or a plastic pipettor tip. The spins can be performed at 4C or at room temperature. Longer spins make it difficult to resuspend cells. 2. Resuspend pellet in 100µl GTE solution and let sit 5 min at room temperature. Be sure cells are completely resuspended. 3. Add 200µl NaOH/SDS solution, mix by tapping tube with finger, and place on ice for 5 min. 4. Add 150µl potassium acetate solution and vortex at maximum speed for 2s to mix. Place on ice for 5-15 min. Be sure mixing is complete. 5. Spin 3 min at 12,000 rpm to pellet cell debris and chromosomal DNA. 6. Transfer 0.4 ml supernatant to a fresh tube, mix it with 0.8 ml of 95% ethanol or 0.4 ml isopropanol, and let sit 2 min at room temperature precipitate nucleic acids. 7. Spin at 12,000rpm for 3 min at room temperature to pellet plasmid DNA and…

1. Definitions and brief statements 1. DNA Data Bank of Japan 2. MeSH Database 3. Please describe the 3 steps and temperature that are cycled during a PCR reaction. 4. What are global alignment and local alignment and their algorithms? ( 5. ProtScale

ersonal use only, do not reple 2021-05-12 1ore 7. Restriction endonucleases recognize particular sequences of DNA and then cut the 16@gmail.com DNA into fragments (see table below). RESTRICTION ENDONUCLEASES BamHI DNA SEQUENCE RECOGNIZED* Luse only, do no repro 2021-05 va16@gmail.com GIG ATC C С СТАGJG GỊA A TT C СТТААЈG Pers EcoRI * Į indicates where the DNA backbone is cut The base sequences of DNA from two different individuals, Alice and Ben, are given below. Indicate where BamHI and EcoRI would cut these DNA sequences by drawing lines (for hints refer to FIGURE 2 and the video in the Canvas assignment for this section ). Personal use ofy 2021-05-12 forevermayal6@gmail.com BEN LA ALICE G C G C uCE G C Personal use only. do no G C 2021-05-12 A T Com G C G C forevermaya16@gnT A C G A T ТА C G C G C G G C G C А Т PersA T G C vermaya16@amail.com T A use only, do not reproduce. 2021-05-12 A T А Т А Т ТА ТА ТА C G 7. Does BamHI cut the DNA from Alice and Ben in the same place? C G…

1. You decide to perform dideoxy sequencing on a PCR product. You add the appropriate 32P- labeled primer, DNA polymerase, DNA template (the PCR product), buffer, DNTP mix, and a small amount of one of the four ddNTPs to four reaction tubes. You run the reactions in the thermal cycler, load each reaction into a separate lane of a polyacrylamide gel, and separate the products by gel electrophoresis. In the figure below, the lanes are labeled according to the ddNTP added. ddATP ddTTP ddCTP ddGTP - Lane 1 2 3 4 a) In lane 5, draw what you would expect to see if you prepared a reaction using a nucleotide mix containing only DATP, DTTP, dCIP, and dGTP. b) In lane 6, draw what you would expect to see if you prepared a reaction using a nucleotide mix containing only ddATP, DTTP, dCIP, dGTP. ||

DNA Restriction, Electrophoresis 1. What are restriction enzymes? 2. How do restriction enzymes function? 3. Why are restriction enzymes important in biochemistry labs? 4. What is DNA Gel Electrophoresis? 5. How does DNA Gel Electrophoresis function? 6. Why is DNA Gel Electrophoresis important in biochemistry labs?

at Arrange Window Help 4) 57% D Tue 4 May Tools Slide Show 2 ARMS PCR nations Slide Show Review View A A =、=<|EE|三v| v v A Sha v 20 Quick Styles D Sha Text Arrange Convert to SmartArt Picture Shapes ab x x. AV v Aa v D. Av A、申。 Box Briefly outline how MLPA probe-sets can simultaneously detect multiple targets using a single set of PCR primers. E Notes Comments MAY 4 Pr w MacBook Air

BIOTECHNOLGY Date: Name: Instructor: Section/Group:. POST-LAB QUESTIONS 1. In one or two sentences, summarize the technique of gel electrophoresis. 2. How does the process of gel electrophoresis separate DNA fragments? 3. Why is the fact that DNA has a negative charge so important in the gel electrophoresis process? Biotechnology 165

13. Technique whereby inserting DNA into a clone is accomplished using two different restriction enzymes Group of answer choices Primer Walking Positional Cloning Directional Cloning Chromosome Walking

2. PCR analysis practice One 1) If you collect samples from crime scene and extract DNA out of each sample. Describe the technologies used to get the below results. 2) Identify which suspect is at the crime scene 3) Among suspect 1-3, who is homozygous for the tested locus and who is heterozygous? DNA from crime scene DNA ladder Suspect DNA #1 #2 #3 500 bp 400 bp 300 bp 200 bp 100 bp | |

Using the techniques below in the laboratory experiments, devise a detailed methodology in solving the situation. -Dna Extraction -Electrophoresis and Quality Checking -Restriction Enzyme Digestion -Polymerase Chain Reaction -Southern Blotting Technique   2. The researchers want to determine if there is a mutation in a carabao farm that leads to high marbling of carabeef marbling. The researchers are knowledgeable and have unlimited funding. In their laboratory they have a PCR, a southern blot chamber and all the materials for DNA extraction. Propose a way to detect if there is a mutation in the carabao marbling.

9. During nucleic acid hybridization, the probe is labelled    for DNA stability   to increase probe-test DNA binding    to identify the location of probe and the test DNA binding   for amplification 11. What is not true for Sequence tagged site (STS) markers:     cannot be mapped by fluorescence in situ hybridization (FISH)   subset of STS markers are known as expressed sequence tag (EST) markers   can readily be screened by a PCR assay   short DNA sequences that occur at a unique location in the genome

You need to complete the following steps for an experiment. Explain whether an acrylamide gel or an agarose gel is more appropriate to use for the following experiments. Purifying tRNA from total RNA Isolating a vector insert for cloning Analyzing PCR products

1. How does PFGE separate larger fragments more efficiently than standard electrophoresis? 2. Why is SYBR green less toxic than EtBr? 3. What are the similarities and differences between Manual and Automated Sanger Sequencing? 4. What is the relationship between DNA fragment length and the distance it will run in a gel? (Restriction Enzyme Digestion)

Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions   5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’   a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest?     b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect?   2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a)  HpaI, recognizes 5’ GTT – AAC 3’   5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’   Number of fragments of DNA:…

Some Steps Involved in Creating  Recombinant DNA  1.  Plasmid DNA is cut at the restriction site.2.  Foreign DNA is cut at the restriction site.3.  Plasmid DNA is opened and sticky ends are formed.4.  Foreign DNA restriction fragments are isolated5.  Target sequence in the plasmid is recognized by the restriction endonuclease.6.  Target sequences in the foreign DNA are recognized by the restriction endonuclease.7.  Foreign DNA restriction fragment is inserted into the plasmid at the restriction site.8.  DNA ligase splices the foreign restriction fragment and the plasmid together.   Identify the correct sequence of steps involved in cutting and reassembling DNA molecules to make recombinant DNA.  Start with preparation of the plasmid DNA. Select one: a. 6, 2, 4, 7, 8, 5, 1, 3 b. 5, 1, 3, 6, 2, 4, 8, 7 c. 5, 1, 3, 6, 2, 4, 7, 8 d. 6, 2, 4, 5, 1, 3, 8, 7

The figure below illustrates the stages of production of useful medical products using recombinant DNA technology. Closely study the figure then answer the Activity 1 questions that follow: Human cell Bacterium 1. DNA Plasmid DNA Human insulin-producing gone 2. DNA is cut with restriction Bacterial DNA with human gone inserted enzymes. 3. Plasmid is reintroduced into bacterium. 4. Engineered bacteria multiply producing insulin. 5. Insulin is Human insulin separated and purified to produce human insulin. 6. Insulin injected into patient 1. What is a plasmid? Make a diagram of bacterial cell containing a plasmid. 2. How do you explain the selection of plasmids for carrying the desired gener 3. Follow the steps of human insulin production, then 4. Make a diagram for the production of growth hormone. first

Hind III' Hind III .9 kb .9 kb Bam HI plasmid A .9 kb .7kb Bam HI .3 kb plasmid B .9 kb .4 kb .3 kb .5 kb/ Eco RI Bgl Il .4 kb Eco RI .7 kb .5 kb -Bgl II Bam HI Eco RI You requested that a lab run by a friend of yours share a couple of plasmids that they created with you. She was willing to send you the ones that you asked for in exchange for citation in any papers that were published using the plasmids. Eco RI However, the labels from two vials have fallen off in the shipping because the adhesive used to hold them was not able to withstand the temperature, being shipped on dry ice. Each vial contained a different plasmid and now you do not know which plasmid is in which. Fortunately, you have restriction maps for both plasmids, shown above. Explain how you would determine which vial contained each plasmid and give a graphical representation of your expectations related to your method of Bam HI discovery. (25pts)

8.  What is the correct order for the steps in a PCR reaction? Group of answer choices annealing, elongation, strand separation strand separation, elongation, annealing strand separation, annealing, elongation elongation, strand separation, annealing

Part 3. Compare the Specificity of DNA-Cutting Tools The flexibility and specificity of CRISPR-Cas9 technology offer a large step forward for gene editing. The first DNA "scissors" were restriction enzymes, which cut DNA at predefined sequences, typically 4-8 base pairs long. For example, EcoRI, a restriction enzyme found in E. coli, will cut double- stranded DNA at every GAATTC sequence. If EcoRI were added to a sample that contained the entire human genome, it could cut at every GAATTC sequence. We can calculate the probability that a particular nucleotide sequence, such as GAATTC, will occur within a larger sequence. Table 1 below shows the calculated probabilities of finding sequences of particular lengths. These calculations are based on the assumption that DNA sequences are entirely random and that every nucleotide position has an equal probability of being A, T, C, or G. Use the table to answer the following questions. Table 1. Calculated probabilities of finding a specific…

Genetic Mutations and Tests Across 3 The second phase of a PCR reaction where the primers bind to the target DNA sequence. 5 Chromosomal mutation that results from non-homologous chromosomes undergoing recombination 9 A prenatal test performed on certain pregnant women by inserting a needle into the womb and retrieving amniotic fluid. 12 The heat-resistant DNA polymerase III enzyme used in PCR reactions. 13 Mutations that are caused by external sources of DNA damage (like radiation) 14 The "P" of the RFLP test. 15 Mutations that change a single amino acid within the protein eing made. 16 Mutations that damage the DNA in eggs or sperm and can be passed down to future generations.

4. Look at the gel image and answer the questions below and be specific. a) Based on your calculations of the DNA concentrations, how much DNA was loaded into each well? Do you see DNA for each of your samples? If not, why do you think that is so? b) Is the DNA in a single sharp band, multiple bands or a smear? What would each of these scenarios be due to, and why would you see them for your samples? c) Do you see multiple bands in your plasmid DNA sample? What are they?

Part 2. PCR 1) In one color, write out the forward primer (5’ GATAC 3’) in the correct position relative to the given template DNA sequence.  In a second color, act as the polymerase and fill in the rest of the new strand of DNA       Primer/New Strand Template DNA:               3’ TAGCTATGCGGACCTCATGCATTAGAGTAG 5’   Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions   5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’   a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest?     b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect?   2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and…

OF intorcat A Intorest gone in a gene "gun," a bacterial material into the genetic material inserts itself into the chromosomes of the host plant. Engineers must also insert a "promoter" gene from a virus as part of the package to make the inserted gene express itself. . This process alone, involving a gene gun or a similar technique, and a promoter, is profoundly different from conventional breeding, even if the primary goal is only to insert genetic material from the same species (Hansen, 2000). host plant cells. Activity 4: Desirable Traits Directions: Study the plants and animals below that have desirable or enhanced traits. Explain how each of the characteristics was introduced or developed (i.e., classical breeding or recombinant DNA technology). MODIFYING TECHNIQUE (Classical breeding/ Recombinant DNA technology) REASON ENHANCED TRAIT 1. Kobe / Wagyu Beef (Beef with good fat distribution)

5) Answers to the following questions. A. You are given a tube containing 275 ng of purified PCR product (DNA) that is 1262 bp long. How many picomoles of PCR product are in the tube? The average weight of a deoxynucleotide monophosphate is 328 g/mol. B. You digest a 5 kb plasmid with two enzymes that yield fragments of 4 kb and 1 kb, and resolve the digest on the gel. What would you predict to see in terms of the intensities of the bands?

DNA EXTRACTION Why do scientists isolate DNA?                                                                                                                    From what part of the subject’s body were cells collected? Give the specific purpose of each experimental step:           Lysis solution & heat:                                                                                             Salt & centrifugation:                                                                                  After centrifuging, where in the tube is the DNA? What is the purpose of adding alcohol?

1. What are some reasons to do PCR? 2. Why do we use a special DNA polymerase from thermophilic bacterium? 3. What are the three temperature ranges used for PCR and what is happening at each step? 4. Why is PCR very susceptible to contamination?   all 4 questions please, thanks!

Why is Nucleic Acid Testing a desirable testing method to use to screen donated blood for viral infections O a. It is the test legally required by the Health Insurance Portability and Accountability Act (HIPAA) O b. It is easy to perform, even without training O c. The procedure has virtually no opportunities for error O d. It can amplify a small amount of DNA or RNA, making it sensitive to detect viruses Next page

10. Here is a graph describing the kinetics of PCR. Answer the questions below. PCR Product (Log 2) C B A PCR Cycle Number i. Reaction is in what phase when it is at point A in the graph? ii. Reaction is in what phase when it is at point B in the graph? iii. Reaction is in what phase when it is at point C in the graph? Name of Phase: 11. ✓ ✓ ✓ DNA DNA was isolated, diluted 1:100 in water, and an optical density (OD) of 0.12 was measured at 260nm." What is the concentration of the DNA solution if you assume that an optical density of 1.0 OD 260 is (2. equivalent to 50ng/μl? 12. (stock solution has a concentration of 3.5 X 10° target DNA molecules/al.. a. If you make a 1:100 dilution of this stock, what is the resulting concentration of the DNA? b. If you add 5 μl of the diluted DNA in part a (above) to a PCR reaction tube. How many target DNA molecules did start with in the PCR reaction tube? 4

Answer the following questions related to PCR Bioinformatics for DNA Extraction using  Why is it necessary to chelate the metal ions from the solution during the boiling/lysis step at 100 degrees celsius? What would happen if you did not use a chelating agent such as the InstaGene matrix? What is needed from the cells for PCR? What structures must be broken to release the DNA from a cell?

A Moving to the next question prevents changes to this answer. Question 1 Which step is NOT included in the technique called Southern blotting? O a. visualization by autoradiography or fluorescence imaging Ob. exposure to a 32p-labeled DNA probe Oc amplification of the restriction fragment-probe duplex d. hybridization of the probe with a restriction fragment having a complementary sequence Oe transfer of the mixture of restriction fragments into a membrane composed of nitrocellulose &Moving to the next question prevents changes to this answer. MacBook Pro esc Q Search Secure Search %23 2 & LO % 4

1. What is the purpose of restriction enzyme? 2. What is the purpose of the probe in DNA finger printing. 3. What is/are the sample that can be used for DNA finger printing? 4. Who is the culprit base on our interactive laboratory experiment?

Question 1. Restriction endonucleases can be isolated from a number of bacteria. In bacteria restriction endonucleases. a-restrict chromosomal DNA that is heavily mutated b-restrict chromosomal DNA with significant regions that have been Deleted. c-restrict the DNA of invading bacteriophages. d- all of the above Question 2. In a PCR reaction the step in which DNA polymerase replicates the DNA is referred to as a- denaturation b- annealing C- extension d- initiation